\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202398699:

Variant ID: vg1202398699 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2398699
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACGGCATCACGATGATGCTGCCATCGTCTAGATAAAAAATTGGAAGTTTGGTTGAAATTGAAACGATGTGATGGAAAAGTTGAAAGTTTGTGTGTGTG[A/G]
GAAAGTTTTGATGTGATGGAAAAGTTAGAAGTTTGAAGAAAAAGTTTGGAACTAAACCAGGCCTAAATACCCGGATGTCCTACAACCACTAGAGTTCTTT

Reverse complement sequence

AAAGAACTCTAGTGGTTGTAGGACATCCGGGTATTTAGGCCTGGTTTAGTTCCAAACTTTTTCTTCAAACTTCTAACTTTTCCATCACATCAAAACTTTC[T/C]
CACACACACAAACTTTCAACTTTTCCATCACATCGTTTCAATTTCAACCAAACTTCCAATTTTTTATCTAGACGATGGCAGCATCATCGTGATGCCGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.40% 0.17% 0.13% NA
All Indica  2759 97.60% 2.00% 0.22% 0.22% NA
All Japonica  1512 6.90% 93.10% 0.00% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 98.80% 0.50% 0.50% 0.17% NA
Indica II  465 96.10% 3.70% 0.00% 0.22% NA
Indica III  913 98.90% 0.80% 0.22% 0.11% NA
Indica Intermediate  786 95.90% 3.60% 0.13% 0.38% NA
Temperate Japonica  767 8.10% 91.90% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 14.10% 85.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202398699 A -> DEL N N silent_mutation Average:46.108; most accessible tissue: Callus, score: 87.997 N N N N
vg1202398699 A -> G LOC_Os12g05330.1 upstream_gene_variant ; 983.0bp to feature; MODIFIER silent_mutation Average:46.108; most accessible tissue: Callus, score: 87.997 N N N N
vg1202398699 A -> G LOC_Os12g05320.1 downstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:46.108; most accessible tissue: Callus, score: 87.997 N N N N
vg1202398699 A -> G LOC_Os12g05334.1 downstream_gene_variant ; 124.0bp to feature; MODIFIER silent_mutation Average:46.108; most accessible tissue: Callus, score: 87.997 N N N N
vg1202398699 A -> G LOC_Os12g05320.2 downstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:46.108; most accessible tissue: Callus, score: 87.997 N N N N
vg1202398699 A -> G LOC_Os12g05330-LOC_Os12g05334 intergenic_region ; MODIFIER silent_mutation Average:46.108; most accessible tissue: Callus, score: 87.997 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202398699 NA 8.33E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.19E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 5.34E-34 mr1081 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.29E-10 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 9.30E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 3.45E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 9.64E-28 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.95E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 5.41E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 9.89E-06 NA mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 3.74E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.96E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 6.59E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 2.73E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 6.33E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.93E-29 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.12E-12 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 2.14E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 6.00E-06 NA mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.98E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.99E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 7.31E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 2.07E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 1.63E-27 mr1686 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 6.28E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 2.91E-24 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 3.48E-07 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 3.86E-06 NA mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 6.70E-06 NA mr1836 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 4.25E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 3.10E-16 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 5.57E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202398699 NA 7.42E-17 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251