\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202282856:

Variant ID: vg1202282856 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2282856
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACTTGACGTAGTTTAAACTGCACTCACTACAAAGGGGCTGCAATAGTAGCATTTGGTTGGGCATGTACTCACTACCAGGGTTCCGACGAAAACCGACC[G/A]
GATTTCGTGAAATTTCGACGTTTCGACGAGGCTCGAAAGTAGAAATCGTCTGAGATTTCGAGAAGTTTCATCCAAATTAAAATTTGAATTGATAAAAAAG

Reverse complement sequence

CTTTTTTATCAATTCAAATTTTAATTTGGATGAAACTTCTCGAAATCTCAGACGATTTCTACTTTCGAGCCTCGTCGAAACGTCGAAATTTCACGAAATC[C/T]
GGTCGGTTTTCGTCGGAACCCTGGTAGTGAGTACATGCCCAACCAAATGCTACTATTGCAGCCCCTTTGTAGTGAGTGCAGTTTAAACTACGTCAAGTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 8.50% 0.02% 0.00% NA
All Indica  2759 93.50% 6.50% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 91.20% 8.70% 0.11% 0.00% NA
Indica Intermediate  786 89.80% 10.20% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202282856 G -> A LOC_Os12g05160.1 upstream_gene_variant ; 567.0bp to feature; MODIFIER silent_mutation Average:37.539; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1202282856 G -> A LOC_Os12g05170.1 downstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:37.539; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1202282856 G -> A LOC_Os12g05160-LOC_Os12g05170 intergenic_region ; MODIFIER silent_mutation Average:37.539; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202282856 NA 4.83E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 4.66E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 5.58E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 5.31E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 6.47E-07 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 8.78E-08 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 4.40E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 3.28E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 3.26E-06 3.26E-06 mr1341 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 4.28E-08 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 1.36E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 1.69E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 1.53E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 1.55E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 7.24E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856 NA 3.96E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251