Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202282856:

Variant ID: vg1202282856 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2282856
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCACTTGACGTAGTTTAAACTGCACTCACTACAAAGGGGCTGCAATAGTAGCATTTGGTTGGGCATGTACTCACTACCAGGGTTCCGACGAAAACCGACC[G/A]
GATTTCGTGAAATTTCGACGTTTCGACGAGGCTCGAAAGTAGAAATCGTCTGAGATTTCGAGAAGTTTCATCCAAATTAAAATTTGAATTGATAAAAAAG

Reverse complement sequence

CTTTTTTATCAATTCAAATTTTAATTTGGATGAAACTTCTCGAAATCTCAGACGATTTCTACTTTCGAGCCTCGTCGAAACGTCGAAATTTCACGAAATC[C/T]
GGTCGGTTTTCGTCGGAACCCTGGTAGTGAGTACATGCCCAACCAAATGCTACTATTGCAGCCCCTTTGTAGTGAGTGCAGTTTAAACTACGTCAAGTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	8.50%	0.02%	0.00%	NA
All Indica	2759	93.50%	6.50%	0.04%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	19.30%	80.70%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	91.20%	8.70%	0.11%	0.00%	NA
Indica Intermediate	786	89.80%	10.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202282856	G -> A	LOC_Os12g05160.1	upstream_gene_variant ; 567.0bp to feature; MODIFIER	silent_mutation	Average:37.539; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1202282856	G -> A	LOC_Os12g05170.1	downstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:37.539; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1202282856	G -> A	LOC_Os12g05160-LOC_Os12g05170	intergenic_region ; MODIFIER	silent_mutation	Average:37.539; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202282856	NA	4.83E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	4.66E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	5.58E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	5.31E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	6.47E-07	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	8.78E-08	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	4.40E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	3.28E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	3.26E-06	3.26E-06	mr1341	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	4.28E-08	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	1.36E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	1.69E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	1.53E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	1.55E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	7.24E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202282856	NA	3.96E-10	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251