\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202258122:

Variant ID: vg1202258122 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2258122
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCGTACCATCACACCCTATATTTAGTATCAGATCCTCTACTAATATGTATCAACCCGGTATCTAGGTATTAGATCCGTTACTCATAGGTATCAAACCC[G/A]
ACCTAGGTATCGAATCCGGTACTTATAGGTATCAGACCCAATACCTAGGTATTAGACTTGGTATTCATAGGTATCATACTCGGTACCTGGGTATCCGACC

Reverse complement sequence

GGTCGGATACCCAGGTACCGAGTATGATACCTATGAATACCAAGTCTAATACCTAGGTATTGGGTCTGATACCTATAAGTACCGGATTCGATACCTAGGT[C/T]
GGGTTTGATACCTATGAGTAACGGATCTAATACCTAGATACCGGGTTGATACATATTAGTAGAGGATCTGATACTAAATATAGGGTGTGATGGTACGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.60% 1.40% 14.64% 47.38% NA
All Indica  2759 3.50% 2.30% 24.07% 70.13% NA
All Japonica  1512 97.40% 0.10% 0.33% 2.18% NA
Aus  269 2.60% 0.00% 6.69% 90.71% NA
Indica I  595 2.20% 1.00% 13.61% 83.19% NA
Indica II  465 5.20% 1.50% 24.30% 69.03% NA
Indica III  913 1.90% 3.60% 30.12% 64.40% NA
Indica Intermediate  786 5.30% 2.30% 24.81% 67.56% NA
Temperate Japonica  767 96.00% 0.30% 0.52% 3.26% NA
Tropical Japonica  504 98.80% 0.00% 0.00% 1.19% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 68.90% 1.10% 5.56% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202258122 G -> DEL N N silent_mutation Average:14.16; most accessible tissue: Callus, score: 34.693 N N N N
vg1202258122 G -> A LOC_Os12g05120.1 upstream_gene_variant ; 4047.0bp to feature; MODIFIER silent_mutation Average:14.16; most accessible tissue: Callus, score: 34.693 N N N N
vg1202258122 G -> A LOC_Os12g05120.2 upstream_gene_variant ; 4045.0bp to feature; MODIFIER silent_mutation Average:14.16; most accessible tissue: Callus, score: 34.693 N N N N
vg1202258122 G -> A LOC_Os12g05120-LOC_Os12g05130 intergenic_region ; MODIFIER silent_mutation Average:14.16; most accessible tissue: Callus, score: 34.693 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202258122 NA 1.25E-32 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 9.55E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 4.40E-28 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 2.43E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 1.08E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 1.19E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 3.48E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 1.48E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 6.04E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122 NA 1.33E-26 mr1386_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251