\
| Variant ID: vg1202258122 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2258122 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTCGTACCATCACACCCTATATTTAGTATCAGATCCTCTACTAATATGTATCAACCCGGTATCTAGGTATTAGATCCGTTACTCATAGGTATCAAACCC[G/A]
ACCTAGGTATCGAATCCGGTACTTATAGGTATCAGACCCAATACCTAGGTATTAGACTTGGTATTCATAGGTATCATACTCGGTACCTGGGTATCCGACC
GGTCGGATACCCAGGTACCGAGTATGATACCTATGAATACCAAGTCTAATACCTAGGTATTGGGTCTGATACCTATAAGTACCGGATTCGATACCTAGGT[C/T]
GGGTTTGATACCTATGAGTAACGGATCTAATACCTAGATACCGGGTTGATACATATTAGTAGAGGATCTGATACTAAATATAGGGTGTGATGGTACGAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.60% | 1.40% | 14.64% | 47.38% | NA |
| All Indica | 2759 | 3.50% | 2.30% | 24.07% | 70.13% | NA |
| All Japonica | 1512 | 97.40% | 0.10% | 0.33% | 2.18% | NA |
| Aus | 269 | 2.60% | 0.00% | 6.69% | 90.71% | NA |
| Indica I | 595 | 2.20% | 1.00% | 13.61% | 83.19% | NA |
| Indica II | 465 | 5.20% | 1.50% | 24.30% | 69.03% | NA |
| Indica III | 913 | 1.90% | 3.60% | 30.12% | 64.40% | NA |
| Indica Intermediate | 786 | 5.30% | 2.30% | 24.81% | 67.56% | NA |
| Temperate Japonica | 767 | 96.00% | 0.30% | 0.52% | 3.26% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 68.90% | 1.10% | 5.56% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202258122 | G -> DEL | N | N | silent_mutation | Average:14.16; most accessible tissue: Callus, score: 34.693 | N | N | N | N |
| vg1202258122 | G -> A | LOC_Os12g05120.1 | upstream_gene_variant ; 4047.0bp to feature; MODIFIER | silent_mutation | Average:14.16; most accessible tissue: Callus, score: 34.693 | N | N | N | N |
| vg1202258122 | G -> A | LOC_Os12g05120.2 | upstream_gene_variant ; 4045.0bp to feature; MODIFIER | silent_mutation | Average:14.16; most accessible tissue: Callus, score: 34.693 | N | N | N | N |
| vg1202258122 | G -> A | LOC_Os12g05120-LOC_Os12g05130 | intergenic_region ; MODIFIER | silent_mutation | Average:14.16; most accessible tissue: Callus, score: 34.693 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202258122 | NA | 1.25E-32 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 9.55E-27 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 4.40E-28 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 2.43E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 1.08E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 1.19E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 3.48E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 1.48E-14 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 6.04E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202258122 | NA | 1.33E-26 | mr1386_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |