Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202199834:

Variant ID: vg1202199834 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 2199834
Reference Allele: AAlternative Allele: C,T,AAT,AAC
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATCAATCAAACCAAATAAAAAGAGAGAGAGAAGAATAACGTTATATTTGCTGTGTTTATTAGTTCACGCTAAAATTAAAAGTTTAGTTGAAATTGGAA[A/C,T,AAT,AAC]
GATGTGACGAAAAAGTTAAAATTTTATGTGAGTAGTAAAGTTTGATGTGATGGGAAAAATTGAAAGTTTGAAGAAAAAGTTTGATACTAAACTCGGCCTA

Reverse complement sequence

TAGGCCGAGTTTAGTATCAAACTTTTTCTTCAAACTTTCAATTTTTCCCATCACATCAAACTTTACTACTCACATAAAATTTTAACTTTTTCGTCACATC[T/G,A,ATT,GTT]
TTCCAATTTCAACTAAACTTTTAATTTTAGCGTGAACTAATAAACACAGCAAATATAACGTTATTCTTCTCTCTCTCTTTTTATTTGGTTTGATTGATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 35.10% 0.08% 0.25% T: 9.69%; AAC: 0.19%; AAT: 0.04%
All Indica  2759 90.60% 1.40% 0.07% 0.40% T: 7.07%; AAC: 0.33%; AAT: 0.04%
All Japonica  1512 2.40% 97.20% 0.00% 0.00% T: 0.40%
Aus  269 4.80% 1.50% 0.00% 0.00% T: 93.31%; AAT: 0.37%
Indica I  595 97.50% 0.30% 0.34% 0.67% T: 1.18%
Indica II  465 93.50% 3.40% 0.00% 0.00% T: 3.01%
Indica III  913 88.30% 0.70% 0.00% 0.33% T: 9.75%; AAC: 0.99%
Indica Intermediate  786 86.50% 2.00% 0.00% 0.51% T: 10.81%; AAT: 0.13%
Temperate Japonica  767 4.00% 95.60% 0.00% 0.00% T: 0.39%
Tropical Japonica  504 1.00% 98.80% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 0.40% 98.80% 0.00% 0.00% T: 0.83%
VI/Aromatic  96 2.10% 93.80% 0.00% 0.00% T: 4.17%
Intermediate  90 34.40% 60.00% 2.22% 1.11% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202199834 A -> C LOC_Os12g05040.3 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> C LOC_Os12g05040.6 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> C LOC_Os12g05040.1 downstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> C LOC_Os12g05040.5 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> C LOC_Os12g05040-LOC_Os12g05050 intergenic_region ; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAT LOC_Os12g05040.3 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAT LOC_Os12g05040.6 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAT LOC_Os12g05040.1 downstream_gene_variant ; 2706.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAT LOC_Os12g05040.5 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAT LOC_Os12g05040-LOC_Os12g05050 intergenic_region ; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAC LOC_Os12g05040.3 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAC LOC_Os12g05040.6 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAC LOC_Os12g05040.1 downstream_gene_variant ; 2706.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAC LOC_Os12g05040.5 downstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> AAC LOC_Os12g05040-LOC_Os12g05050 intergenic_region ; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> T LOC_Os12g05040.3 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> T LOC_Os12g05040.6 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> T LOC_Os12g05040.1 downstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> T LOC_Os12g05040.5 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> T LOC_Os12g05040-LOC_Os12g05050 intergenic_region ; MODIFIER silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N
vg1202199834 A -> DEL N N silent_mutation Average:79.807; most accessible tissue: Minghui63 panicle, score: 97.008 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1202199834 A AAC 0.07 0.06 0.07 0.08 0.05 0.05
vg1202199834 A AAT 0.07 0.05 0.06 0.07 0.03 0.03
vg1202199834 A C -0.01 -0.01 -0.01 -0.02 -0.01 0.0
vg1202199834 A T -0.01 -0.01 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202199834 NA 5.62E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202199834 1.19E-06 8.83E-08 mr1496 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251