\
| Variant ID: vg1202110385 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2110385 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )
CCGTACAGGATGGCGGCCAACGAACTAGCAAAGGTCAAGAAGCAGGTTGATGAGCAGCTGCAGAAAGGGTACATACGACCAAGTACTTCACCTTGGGGTG[C/T]
TCCGGTCATTTTTGTGGAGAAAAAGGATAAGACGAAGAGGATGTGCGTTGATTATCGCGCACTCAATGAGGTCACAATCAAGAATAAATATCCTTTACCG
CGGTAAAGGATATTTATTCTTGATTGTGACCTCATTGAGTGCGCGATAATCAACGCACATCCTCTTCGTCTTATCCTTTTTCTCCACAAAAATGACCGGA[G/A]
CACCCCAAGGTGAAGTACTTGGTCGTATGTACCCTTTCTGCAGCTGCTCATCAACCTGCTTCTTGACCTTTGCTAGTTCGTTGGCCGCCATCCTGTACGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.90% | 15.70% | 6.37% | 12.00% | NA |
| All Indica | 2759 | 52.30% | 22.50% | 9.39% | 15.80% | NA |
| All Japonica | 1512 | 82.70% | 7.00% | 2.38% | 7.87% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 74.30% | 4.40% | 2.86% | 18.49% | NA |
| Indica II | 465 | 47.50% | 16.60% | 13.55% | 22.37% | NA |
| Indica III | 913 | 34.40% | 42.30% | 11.17% | 12.16% | NA |
| Indica Intermediate | 786 | 59.30% | 16.80% | 9.80% | 14.12% | NA |
| Temperate Japonica | 767 | 93.90% | 0.10% | 1.04% | 4.95% | NA |
| Tropical Japonica | 504 | 63.50% | 20.60% | 2.58% | 13.29% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.40% | 6.22% | 5.81% | NA |
| VI/Aromatic | 96 | 89.60% | 9.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 6.70% | 5.56% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202110385 | C -> DEL | LOC_Os12g04910.1 | N | frameshift_variant | Average:18.889; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1202110385 | C -> T | LOC_Os12g04910.1 | missense_variant ; p.Ala590Val; MODERATE | nonsynonymous_codon ; A590V | Average:18.889; most accessible tissue: Minghui63 panicle, score: 34.226 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202110385 | NA | 5.19E-07 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 4.58E-09 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 2.46E-08 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 6.22E-10 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 1.07E-06 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 5.25E-06 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 2.34E-12 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 2.69E-09 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | 5.59E-06 | 1.24E-12 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 3.75E-12 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 1.83E-08 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 1.82E-07 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 2.39E-09 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 2.93E-10 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | 6.65E-06 | 4.54E-08 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 1.52E-12 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202110385 | NA | 8.36E-08 | mr1961_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |