\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202109317:

Variant ID: vg1202109317 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2109317
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACGAGCTGACCAACCAACTGATATCTGGGGACTACGCTGATTTTGAAAGGCTGGTTGACAAGGCAATCCGTCAGGAGGATCAGCGCAACAAAATGGAC[G/A]
GGAAGAGAAAGGCGGCGCAGCTCCGGTCCAACCAAGGTAGTCAGCACCGACCGCGCTTCACTCCCGGATAGCAGGGTGGACCTACCACCATGATCGTCCG

Reverse complement sequence

CGGACGATCATGGTGGTAGGTCCACCCTGCTATCCGGGAGTGAAGCGCGGTCGGTGCTGACTACCTTGGTTGGACCGGAGCTGCGCCGCCTTTCTCTTCC[C/T]
GTCCATTTTGTTGCGCTGATCCTCCTGACGGATTGCCTTGTCAACCAGCCTTTCAAAATCAGCGTAGTCCCCAGATATCAGTTGGTTGGTCAGCTCGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.40% 11.90% 5.61% 49.09% NA
All Indica  2759 5.30% 10.50% 8.34% 75.82% NA
All Japonica  1512 85.80% 0.20% 0.99% 12.96% NA
Aus  269 1.50% 94.80% 1.86% 1.86% NA
Indica I  595 6.90% 2.00% 7.23% 83.87% NA
Indica II  465 6.20% 9.70% 12.26% 71.83% NA
Indica III  913 2.50% 13.70% 6.24% 77.55% NA
Indica Intermediate  786 6.70% 13.90% 9.29% 70.10% NA
Temperate Japonica  767 95.30% 0.00% 0.26% 4.43% NA
Tropical Japonica  504 66.10% 0.40% 2.58% 30.95% NA
Japonica Intermediate  241 97.10% 0.40% 0.00% 2.49% NA
VI/Aromatic  96 85.40% 4.20% 7.29% 3.12% NA
Intermediate  90 55.60% 8.90% 8.89% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202109317 G -> DEL LOC_Os12g04910.1 N frameshift_variant Average:9.806; most accessible tissue: Callus, score: 33.245 N N N N
vg1202109317 G -> A LOC_Os12g04910.1 missense_variant ; p.Gly265Arg; MODERATE nonsynonymous_codon ; G265R Average:9.806; most accessible tissue: Callus, score: 33.245 benign -1.44 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202109317 NA 2.07E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 7.40E-06 4.99E-23 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 4.50E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 3.31E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 1.07E-16 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 3.66E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 3.82E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 3.59E-06 mr1232_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 1.32E-17 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 5.50E-08 mr1557_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 1.95E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202109317 NA 4.70E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251