Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202108891:

Variant ID: vg1202108891 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2108891
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCCAAGTTGCCAGAGTTTCTACGCGTCAGGCCACCTACCTTCTCCAGCATCACCAACCCCATGGAGGCGAATGACTGGCTCCATGCCATAGAGAAGAAG[T/C]
TGAATCTCCTGCAGTGCAATGATCAGGAGAAGGTCGCTTTCGCCACACACCAGCTTCAAGGTCCCGCGTCAGCTTGGTGGGACAATCACATGGCCACCCG

Reverse complement sequence

CGGGTGGCCATGTGATTGTCCCACCAAGCTGACGCGGGACCTTGAAGCTGGTGTGTGGCGAAAGCGACCTTCTCCTGATCATTGCACTGCAGGAGATTCA[A/G]
CTTCTTCTCTATGGCATGGAGCCAGTCATTCGCCTCCATGGGGTTGGTGATGCTGGAGAAGGTAGGTGGCCTGACGCGTAGAAACTCTGGCAACTTGGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.90%	9.00%	16.61%	39.48%	NA
All Indica	2759	6.90%	5.90%	27.15%	60.02%	NA
All Japonica	1512	86.40%	0.10%	1.06%	12.37%	NA
Aus	269	1.50%	93.70%	3.35%	1.49%	NA
Indica I	595	8.70%	1.30%	9.24%	80.67%	NA
Indica II	465	9.70%	1.50%	38.92%	49.89%	NA
Indica III	913	3.10%	8.80%	31.11%	57.06%	NA
Indica Intermediate	786	8.30%	8.80%	29.13%	53.82%	NA
Temperate Japonica	767	95.40%	0.00%	0.26%	4.30%	NA
Tropical Japonica	504	67.70%	0.20%	2.78%	29.37%	NA
Japonica Intermediate	241	97.10%	0.40%	0.00%	2.49%	NA
VI/Aromatic	96	92.70%	4.20%	1.04%	2.08%	NA
Intermediate	90	65.60%	4.40%	11.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202108891	T -> C	LOC_Os12g04910.1	synonymous_variant ; p.Leu123Leu; LOW	synonymous_codon	Average:10.291; most accessible tissue: Callus, score: 31.799	N	N	N	N
vg1202108891	T -> DEL	LOC_Os12g04910.1	N	frameshift_variant	Average:10.291; most accessible tissue: Callus, score: 31.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202108891	1.61E-07	3.18E-07	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	3.56E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	3.96E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	1.06E-22	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	1.89E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	1.36E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	1.77E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	1.86E-06	3.68E-08	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	4.06E-18	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	8.49E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	2.24E-06	NA	mr1213	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	6.57E-06	2.69E-07	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	9.40E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	6.29E-06	NA	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	8.47E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	1.35E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	1.57E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	3.01E-08	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	4.82E-06	mr1367	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	1.96E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	8.84E-06	mr1400	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	1.56E-07	4.34E-09	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	6.33E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	4.61E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	5.16E-21	mr1589	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	1.52E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	2.23E-12	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	4.50E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891	NA	2.91E-22	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251