\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202108891:

Variant ID: vg1202108891 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2108891
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCAAGTTGCCAGAGTTTCTACGCGTCAGGCCACCTACCTTCTCCAGCATCACCAACCCCATGGAGGCGAATGACTGGCTCCATGCCATAGAGAAGAAG[T/C]
TGAATCTCCTGCAGTGCAATGATCAGGAGAAGGTCGCTTTCGCCACACACCAGCTTCAAGGTCCCGCGTCAGCTTGGTGGGACAATCACATGGCCACCCG

Reverse complement sequence

CGGGTGGCCATGTGATTGTCCCACCAAGCTGACGCGGGACCTTGAAGCTGGTGTGTGGCGAAAGCGACCTTCTCCTGATCATTGCACTGCAGGAGATTCA[A/G]
CTTCTTCTCTATGGCATGGAGCCAGTCATTCGCCTCCATGGGGTTGGTGATGCTGGAGAAGGTAGGTGGCCTGACGCGTAGAAACTCTGGCAACTTGGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.90% 9.00% 16.61% 39.48% NA
All Indica  2759 6.90% 5.90% 27.15% 60.02% NA
All Japonica  1512 86.40% 0.10% 1.06% 12.37% NA
Aus  269 1.50% 93.70% 3.35% 1.49% NA
Indica I  595 8.70% 1.30% 9.24% 80.67% NA
Indica II  465 9.70% 1.50% 38.92% 49.89% NA
Indica III  913 3.10% 8.80% 31.11% 57.06% NA
Indica Intermediate  786 8.30% 8.80% 29.13% 53.82% NA
Temperate Japonica  767 95.40% 0.00% 0.26% 4.30% NA
Tropical Japonica  504 67.70% 0.20% 2.78% 29.37% NA
Japonica Intermediate  241 97.10% 0.40% 0.00% 2.49% NA
VI/Aromatic  96 92.70% 4.20% 1.04% 2.08% NA
Intermediate  90 65.60% 4.40% 11.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202108891 T -> C LOC_Os12g04910.1 synonymous_variant ; p.Leu123Leu; LOW synonymous_codon Average:10.291; most accessible tissue: Callus, score: 31.799 N N N N
vg1202108891 T -> DEL LOC_Os12g04910.1 N frameshift_variant Average:10.291; most accessible tissue: Callus, score: 31.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202108891 1.61E-07 3.18E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 3.56E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 3.96E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 1.06E-22 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 1.89E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 1.36E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 1.77E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 1.86E-06 3.68E-08 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 4.06E-18 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 8.49E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 2.24E-06 NA mr1213 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 6.57E-06 2.69E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 9.40E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 6.29E-06 NA mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 8.47E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 1.35E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 1.57E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 3.01E-08 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 4.82E-06 mr1367 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 1.96E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 8.84E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 1.56E-07 4.34E-09 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 6.33E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 4.61E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 5.16E-21 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 1.52E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 2.23E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 4.50E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108891 NA 2.91E-22 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251