\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202108841:

Variant ID: vg1202108841 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2108841
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCAGCATGCCGAACAACAGCACCAGCAGTTTGGTCCCCCTCCCCCTCAGTCCAAGTTGCCAGAGTTTCTACGCGTCAGGCCACCTACCTTCTCCAGCA[T/C]
CACCAACCCCATGGAGGCGAATGACTGGCTCCATGCCATAGAGAAGAAGTTGAATCTCCTGCAGTGCAATGATCAGGAGAAGGTCGCTTTCGCCACACAC

Reverse complement sequence

GTGTGTGGCGAAAGCGACCTTCTCCTGATCATTGCACTGCAGGAGATTCAACTTCTTCTCTATGGCATGGAGCCAGTCATTCGCCTCCATGGGGTTGGTG[A/G]
TGCTGGAGAAGGTAGGTGGCCTGACGCGTAGAAACTCTGGCAACTTGGACTGAGGGGGAGGGGGACCAAACTGCTGGTGCTGTTGTTCGGCATGCTGCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 9.10% 17.03% 39.91% NA
All Indica  2759 6.00% 6.10% 27.80% 60.17% NA
All Japonica  1512 86.00% 0.10% 0.53% 13.29% NA
Aus  269 1.50% 93.70% 3.35% 1.49% NA
Indica I  595 7.70% 1.30% 10.92% 80.00% NA
Indica II  465 5.80% 2.20% 40.22% 51.83% NA
Indica III  913 3.10% 8.80% 31.00% 57.17% NA
Indica Intermediate  786 8.10% 8.80% 29.52% 53.56% NA
Temperate Japonica  767 95.40% 0.00% 0.26% 4.30% NA
Tropical Japonica  504 66.50% 0.20% 1.19% 32.14% NA
Japonica Intermediate  241 97.10% 0.40% 0.00% 2.49% NA
VI/Aromatic  96 86.50% 4.20% 7.29% 2.08% NA
Intermediate  90 58.90% 4.40% 15.56% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202108841 T -> C LOC_Os12g04910.1 missense_variant ; p.Ile106Thr; MODERATE nonsynonymous_codon ; I106T Average:10.367; most accessible tissue: Callus, score: 31.799 unknown unknown TOLERATED 1.00
vg1202108841 T -> DEL LOC_Os12g04910.1 N frameshift_variant Average:10.367; most accessible tissue: Callus, score: 31.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202108841 NA 1.59E-15 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 2.94E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 8.04E-08 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 3.38E-09 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 4.63E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 5.00E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 2.64E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 2.96E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 8.26E-07 NA mr1416 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 2.53E-07 5.71E-07 mr1416 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 2.25E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 3.85E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 3.21E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 1.31E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 2.96E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 5.35E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 5.27E-07 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 1.28E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 3.26E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 1.46E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 3.49E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 1.46E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 2.01E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 1.60E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 8.72E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 3.93E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 4.67E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 1.77E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 1.33E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 1.71E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108841 NA 4.99E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251