Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202108506:

Variant ID: vg1202108506 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2108506
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTTGCTGTTTAAAGTGTTTTAATTCAGATCAGAACAATTGCAGTTTAAATTTCTATATAATAAAGCTTAGTTCCTGAGCATCTGTTTTTCTCCGTTTCC[C/T]
CGTCTGCCCTTCCTCCAGATGGTCTACACCAGAACTGGCACCCGCACGACTGGCGAGGGCAGCAACGGCGAAGAACGCGCTGATGGTGTGCACCCCAACA

Reverse complement sequence

TGTTGGGGTGCACACCATCAGCGCGTTCTTCGCCGTTGCTGCCCTCGCCAGTCGTGCGGGTGCCAGTTCTGGTGTAGACCATCTGGAGGAAGGGCAGACG[G/A]
GGAAACGGAGAAAAACAGATGCTCAGGAACTAAGCTTTATTATATAGAAATTTAAACTGCAATTGTTCTGATCTGAATTAAAACACTTTAAACAGCAAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	1.10%	19.97%	18.28%	NA
All Indica	2759	41.50%	1.40%	29.90%	27.26%	NA
All Japonica	1512	86.30%	1.00%	6.15%	6.55%	NA
Aus	269	98.10%	0.00%	1.49%	0.37%	NA
Indica I	595	68.20%	0.00%	5.71%	26.05%	NA
Indica II	465	28.60%	1.30%	33.12%	36.99%	NA
Indica III	913	26.00%	2.70%	46.77%	24.53%	NA
Indica Intermediate	786	46.80%	0.90%	26.72%	25.57%	NA
Temperate Japonica	767	95.60%	0.00%	0.26%	4.17%	NA
Tropical Japonica	504	66.90%	2.80%	18.06%	12.30%	NA
Japonica Intermediate	241	97.50%	0.40%	0.00%	2.07%	NA
VI/Aromatic	96	88.50%	0.00%	11.46%	0.00%	NA
Intermediate	90	74.40%	0.00%	12.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202108506	C -> DEL	N	N	silent_mutation	Average:9.485; most accessible tissue: Callus, score: 35.209	N	N	N	N
vg1202108506	C -> T	LOC_Os12g04910.1	upstream_gene_variant ; 19.0bp to feature; MODIFIER	silent_mutation	Average:9.485; most accessible tissue: Callus, score: 35.209	N	N	N	N
vg1202108506	C -> T	LOC_Os12g04900.1	downstream_gene_variant ; 231.0bp to feature; MODIFIER	silent_mutation	Average:9.485; most accessible tissue: Callus, score: 35.209	N	N	N	N
vg1202108506	C -> T	LOC_Os12g04900-LOC_Os12g04910	intergenic_region ; MODIFIER	silent_mutation	Average:9.485; most accessible tissue: Callus, score: 35.209	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202108506	NA	2.67E-12	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	2.90E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	5.65E-16	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	1.06E-06	8.59E-10	mr1496	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	7.49E-11	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	2.33E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	4.01E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	2.67E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	3.57E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	5.77E-12	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	8.72E-07	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	5.11E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	2.88E-14	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506	NA	1.66E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251