\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202108506:

Variant ID: vg1202108506 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2108506
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTGCTGTTTAAAGTGTTTTAATTCAGATCAGAACAATTGCAGTTTAAATTTCTATATAATAAAGCTTAGTTCCTGAGCATCTGTTTTTCTCCGTTTCC[C/T]
CGTCTGCCCTTCCTCCAGATGGTCTACACCAGAACTGGCACCCGCACGACTGGCGAGGGCAGCAACGGCGAAGAACGCGCTGATGGTGTGCACCCCAACA

Reverse complement sequence

TGTTGGGGTGCACACCATCAGCGCGTTCTTCGCCGTTGCTGCCCTCGCCAGTCGTGCGGGTGCCAGTTCTGGTGTAGACCATCTGGAGGAAGGGCAGACG[G/A]
GGAAACGGAGAAAAACAGATGCTCAGGAACTAAGCTTTATTATATAGAAATTTAAACTGCAATTGTTCTGATCTGAATTAAAACACTTTAAACAGCAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 1.10% 19.97% 18.28% NA
All Indica  2759 41.50% 1.40% 29.90% 27.26% NA
All Japonica  1512 86.30% 1.00% 6.15% 6.55% NA
Aus  269 98.10% 0.00% 1.49% 0.37% NA
Indica I  595 68.20% 0.00% 5.71% 26.05% NA
Indica II  465 28.60% 1.30% 33.12% 36.99% NA
Indica III  913 26.00% 2.70% 46.77% 24.53% NA
Indica Intermediate  786 46.80% 0.90% 26.72% 25.57% NA
Temperate Japonica  767 95.60% 0.00% 0.26% 4.17% NA
Tropical Japonica  504 66.90% 2.80% 18.06% 12.30% NA
Japonica Intermediate  241 97.50% 0.40% 0.00% 2.07% NA
VI/Aromatic  96 88.50% 0.00% 11.46% 0.00% NA
Intermediate  90 74.40% 0.00% 12.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202108506 C -> DEL N N silent_mutation Average:9.485; most accessible tissue: Callus, score: 35.209 N N N N
vg1202108506 C -> T LOC_Os12g04910.1 upstream_gene_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:9.485; most accessible tissue: Callus, score: 35.209 N N N N
vg1202108506 C -> T LOC_Os12g04900.1 downstream_gene_variant ; 231.0bp to feature; MODIFIER silent_mutation Average:9.485; most accessible tissue: Callus, score: 35.209 N N N N
vg1202108506 C -> T LOC_Os12g04900-LOC_Os12g04910 intergenic_region ; MODIFIER silent_mutation Average:9.485; most accessible tissue: Callus, score: 35.209 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202108506 NA 2.67E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 2.90E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 5.65E-16 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 1.06E-06 8.59E-10 mr1496 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 7.49E-11 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 2.33E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 4.01E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 2.67E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 3.57E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 5.77E-12 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 8.72E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 5.11E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 2.88E-14 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202108506 NA 1.66E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251