| Variant ID: vg1202108506 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2108506 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCTTGCTGTTTAAAGTGTTTTAATTCAGATCAGAACAATTGCAGTTTAAATTTCTATATAATAAAGCTTAGTTCCTGAGCATCTGTTTTTCTCCGTTTCC[C/T]
CGTCTGCCCTTCCTCCAGATGGTCTACACCAGAACTGGCACCCGCACGACTGGCGAGGGCAGCAACGGCGAAGAACGCGCTGATGGTGTGCACCCCAACA
TGTTGGGGTGCACACCATCAGCGCGTTCTTCGCCGTTGCTGCCCTCGCCAGTCGTGCGGGTGCCAGTTCTGGTGTAGACCATCTGGAGGAAGGGCAGACG[G/A]
GGAAACGGAGAAAAACAGATGCTCAGGAACTAAGCTTTATTATATAGAAATTTAAACTGCAATTGTTCTGATCTGAATTAAAACACTTTAAACAGCAAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 1.10% | 19.97% | 18.28% | NA |
| All Indica | 2759 | 41.50% | 1.40% | 29.90% | 27.26% | NA |
| All Japonica | 1512 | 86.30% | 1.00% | 6.15% | 6.55% | NA |
| Aus | 269 | 98.10% | 0.00% | 1.49% | 0.37% | NA |
| Indica I | 595 | 68.20% | 0.00% | 5.71% | 26.05% | NA |
| Indica II | 465 | 28.60% | 1.30% | 33.12% | 36.99% | NA |
| Indica III | 913 | 26.00% | 2.70% | 46.77% | 24.53% | NA |
| Indica Intermediate | 786 | 46.80% | 0.90% | 26.72% | 25.57% | NA |
| Temperate Japonica | 767 | 95.60% | 0.00% | 0.26% | 4.17% | NA |
| Tropical Japonica | 504 | 66.90% | 2.80% | 18.06% | 12.30% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.40% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 11.46% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 12.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202108506 | C -> DEL | N | N | silent_mutation | Average:9.485; most accessible tissue: Callus, score: 35.209 | N | N | N | N |
| vg1202108506 | C -> T | LOC_Os12g04910.1 | upstream_gene_variant ; 19.0bp to feature; MODIFIER | silent_mutation | Average:9.485; most accessible tissue: Callus, score: 35.209 | N | N | N | N |
| vg1202108506 | C -> T | LOC_Os12g04900.1 | downstream_gene_variant ; 231.0bp to feature; MODIFIER | silent_mutation | Average:9.485; most accessible tissue: Callus, score: 35.209 | N | N | N | N |
| vg1202108506 | C -> T | LOC_Os12g04900-LOC_Os12g04910 | intergenic_region ; MODIFIER | silent_mutation | Average:9.485; most accessible tissue: Callus, score: 35.209 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202108506 | NA | 2.67E-12 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | NA | 2.90E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | NA | 5.65E-16 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | 1.06E-06 | 8.59E-10 | mr1496 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | NA | 7.49E-11 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | NA | 2.33E-08 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | NA | 4.01E-07 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | NA | 2.67E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | NA | 3.57E-06 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202108506 | NA | 5.77E-12 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/