\
| Variant ID: vg1202107651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2107651 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGAGGCAGCCTACCTGATGATGGCCAGACTATGGGAGCGCCACAACTACATCTTCCACGACACGGCGTACCGCTTCCACCCTCGTCGAGCCAGCGGCAG[C/A]
GATGTCAGTTCTTTCCGTCCGACAGCCGGTGAGAACGACACCACCTTCGGTCACATGTGCGCTGTGATGAGGGGGATGGACAGGATGCACTCGGACCTGC
GCAGGTCCGAGTGCATCCTGTCCATCCCCCTCATCACAGCGCACATGTGACCGAAGGTGGTGTCGTTCTCACCGGCTGTCGGACGGAAAGAACTGACATC[G/T]
CTGCCGCTGGCTCGACGAGGGTGGAAGCGGTACGCCGTGTCGTGGAAGATGTAGTTGTGGCGCTCCCATAGTCTGGCCATCATCAGGTAGGCTGCCTCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 0.10% | 32.73% | 14.09% | NA |
| All Indica | 2759 | 27.90% | 0.30% | 51.18% | 20.66% | NA |
| All Japonica | 1512 | 86.90% | 0.00% | 7.47% | 5.62% | NA |
| Aus | 269 | 97.40% | 0.00% | 2.23% | 0.37% | NA |
| Indica I | 595 | 19.80% | 0.30% | 55.63% | 24.20% | NA |
| Indica II | 465 | 24.50% | 0.40% | 44.09% | 30.97% | NA |
| Indica III | 913 | 31.70% | 0.00% | 54.33% | 14.02% | NA |
| Indica Intermediate | 786 | 31.70% | 0.40% | 48.35% | 19.59% | NA |
| Temperate Japonica | 767 | 95.60% | 0.00% | 0.52% | 3.91% | NA |
| Tropical Japonica | 504 | 68.50% | 0.00% | 21.03% | 10.52% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 1.24% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 14.44% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202107651 | C -> DEL | LOC_Os12g04900.1 | N | frameshift_variant | Average:27.063; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg1202107651 | C -> A | LOC_Os12g04900.1 | missense_variant ; p.Ser111Arg; MODERATE | nonsynonymous_codon ; S111R | Average:27.063; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | benign |
1.435 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202107651 | NA | 3.65E-43 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 1.30E-19 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 4.76E-14 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | 7.68E-06 | 2.89E-41 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 1.72E-18 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 1.40E-06 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 1.04E-14 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 1.72E-06 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 9.84E-20 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | 2.65E-06 | 8.23E-23 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 4.11E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | 5.47E-07 | 3.29E-44 | mr1161_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 2.64E-21 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 5.22E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 5.59E-25 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 4.21E-21 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 2.09E-08 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202107651 | NA | 7.80E-07 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |