\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202107651:

Variant ID: vg1202107651 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2107651
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAGGCAGCCTACCTGATGATGGCCAGACTATGGGAGCGCCACAACTACATCTTCCACGACACGGCGTACCGCTTCCACCCTCGTCGAGCCAGCGGCAG[C/A]
GATGTCAGTTCTTTCCGTCCGACAGCCGGTGAGAACGACACCACCTTCGGTCACATGTGCGCTGTGATGAGGGGGATGGACAGGATGCACTCGGACCTGC

Reverse complement sequence

GCAGGTCCGAGTGCATCCTGTCCATCCCCCTCATCACAGCGCACATGTGACCGAAGGTGGTGTCGTTCTCACCGGCTGTCGGACGGAAAGAACTGACATC[G/T]
CTGCCGCTGGCTCGACGAGGGTGGAAGCGGTACGCCGTGTCGTGGAAGATGTAGTTGTGGCGCTCCCATAGTCTGGCCATCATCAGGTAGGCTGCCTCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 0.10% 32.73% 14.09% NA
All Indica  2759 27.90% 0.30% 51.18% 20.66% NA
All Japonica  1512 86.90% 0.00% 7.47% 5.62% NA
Aus  269 97.40% 0.00% 2.23% 0.37% NA
Indica I  595 19.80% 0.30% 55.63% 24.20% NA
Indica II  465 24.50% 0.40% 44.09% 30.97% NA
Indica III  913 31.70% 0.00% 54.33% 14.02% NA
Indica Intermediate  786 31.70% 0.40% 48.35% 19.59% NA
Temperate Japonica  767 95.60% 0.00% 0.52% 3.91% NA
Tropical Japonica  504 68.50% 0.00% 21.03% 10.52% NA
Japonica Intermediate  241 97.90% 0.00% 1.24% 0.83% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 74.40% 0.00% 14.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202107651 C -> DEL LOC_Os12g04900.1 N frameshift_variant Average:27.063; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg1202107651 C -> A LOC_Os12g04900.1 missense_variant ; p.Ser111Arg; MODERATE nonsynonymous_codon ; S111R Average:27.063; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 benign 1.435 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202107651 NA 3.65E-43 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 1.30E-19 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 4.76E-14 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 7.68E-06 2.89E-41 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 1.72E-18 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 1.40E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 1.04E-14 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 1.72E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 9.84E-20 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 2.65E-06 8.23E-23 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 4.11E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 5.47E-07 3.29E-44 mr1161_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 2.64E-21 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 5.22E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 5.59E-25 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 4.21E-21 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 2.09E-08 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107651 NA 7.80E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251