\
| Variant ID: vg1202073188 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2073188 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTCTGGGTCACGTCATTACTGCTCAAGGTGTGGCAGTGGATCCGTCGAATGTGGAGTCAGTTACTAAGTGGACCCCACCAAAGACAATTTTTCAGATCC[G/A]
GAGTTTTCTTGGACTTGCGGGTTATTACCGTCGGTTCATCGAAAATTTCTCTAAGATTGCCAGACCCATGACTCAGTTGCTGAAGAAAGATGAAAATTTT
AAAATTTTCATCTTTCTTCAGCAACTGAGTCATGGGTCTGGCAATCTTAGAGAAATTTTCGATGAACCGACGGTAATAACCCGCAAGTCCAAGAAAACTC[C/T]
GGATCTGAAAAATTGTCTTTGGTGGGGTCCACTTAGTAACTGACTCCACATTCGACGGATCCACTGCCACACCTTGAGCAGTAATGACGTGACCCAGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.40% | 0.80% | 2.41% | 46.36% | NA |
| All Indica | 2759 | 17.60% | 1.40% | 4.02% | 76.95% | NA |
| All Japonica | 1512 | 97.90% | 0.00% | 0.07% | 1.98% | NA |
| Aus | 269 | 94.40% | 0.00% | 0.37% | 5.20% | NA |
| Indica I | 595 | 21.20% | 1.20% | 3.87% | 73.78% | NA |
| Indica II | 465 | 15.90% | 2.20% | 9.46% | 72.47% | NA |
| Indica III | 913 | 11.60% | 1.10% | 1.64% | 85.65% | NA |
| Indica Intermediate | 786 | 22.80% | 1.70% | 3.69% | 71.88% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 0.00% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202073188 | G -> DEL | LOC_Os12g04830.1 | N | frameshift_variant | Average:10.868; most accessible tissue: Callus, score: 31.634 | N | N | N | N |
| vg1202073188 | G -> A | LOC_Os12g04830.1 | missense_variant ; p.Arg867Gln; MODERATE | stop_gained | Average:10.868; most accessible tissue: Callus, score: 31.634 | N | N | N | N |
| vg1202073188 | G -> A | LOC_Os12g04830.1 | missense_variant ; p.Arg867Gln; MODERATE | nonsynonymous_codon ; R867Q | Average:10.868; most accessible tissue: Callus, score: 31.634 | unknown | unknown | DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202073188 | NA | 2.99E-08 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | NA | 6.37E-08 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | 2.00E-07 | 1.67E-23 | mr1255 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | 1.67E-06 | 2.62E-10 | mr1255 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | NA | 6.83E-08 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | NA | 3.57E-06 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | NA | 1.71E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | NA | 9.88E-09 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | NA | 3.00E-08 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | NA | 5.01E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202073188 | NA | 5.80E-07 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |