\
| Variant ID: vg1202009958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2009958 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 245. )
CAGATCTGTAGCCAGCTACGGCACGAACTCCAAGATATAATGTGTGTATGACAAGTGGGACCAGATAATTATAGTATAGTAAACAACTATTATATAAATT[G/A]
GCTATTACATTAATTATAAATGTTTTGGAGCTAATAGTGGACTATACTATTAAACTTGCTCTTACGTTACCGGTAATGACCATGCAAGCACATGGTAGCA
TGCTACCATGTGCTTGCATGGTCATTACCGGTAACGTAAGAGCAAGTTTAATAGTATAGTCCACTATTAGCTCCAAAACATTTATAATTAATGTAATAGC[C/T]
AATTTATATAATAGTTGTTTACTATACTATAATTATCTGGTCCCACTTGTCATACACACATTATATCTTGGAGTTCGTGCCGTAGCTGGCTACAGATCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 9.30% | 0.95% | 0.00% | NA |
| All Indica | 2759 | 91.80% | 6.60% | 1.59% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.40% | 92.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 4.70% | 4.20% | 0.00% | NA |
| Indica II | 465 | 96.30% | 2.20% | 1.51% | 0.00% | NA |
| Indica III | 913 | 90.90% | 8.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 8.00% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202009958 | G -> A | LOC_Os12g04720.1 | downstream_gene_variant ; 247.0bp to feature; MODIFIER | silent_mutation | Average:63.039; most accessible tissue: Callus, score: 90.027 | N | N | N | N |
| vg1202009958 | G -> A | LOC_Os12g04740.1 | downstream_gene_variant ; 2826.0bp to feature; MODIFIER | silent_mutation | Average:63.039; most accessible tissue: Callus, score: 90.027 | N | N | N | N |
| vg1202009958 | G -> A | LOC_Os12g04720.2 | downstream_gene_variant ; 247.0bp to feature; MODIFIER | silent_mutation | Average:63.039; most accessible tissue: Callus, score: 90.027 | N | N | N | N |
| vg1202009958 | G -> A | LOC_Os12g04740.3 | downstream_gene_variant ; 2826.0bp to feature; MODIFIER | silent_mutation | Average:63.039; most accessible tissue: Callus, score: 90.027 | N | N | N | N |
| vg1202009958 | G -> A | LOC_Os12g04740.2 | downstream_gene_variant ; 2826.0bp to feature; MODIFIER | silent_mutation | Average:63.039; most accessible tissue: Callus, score: 90.027 | N | N | N | N |
| vg1202009958 | G -> A | LOC_Os12g04710-LOC_Os12g04720 | intergenic_region ; MODIFIER | silent_mutation | Average:63.039; most accessible tissue: Callus, score: 90.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202009958 | NA | 4.39E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 1.90E-16 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 3.33E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 1.02E-20 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 1.79E-29 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 1.50E-25 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 6.52E-06 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 1.60E-06 | mr1305_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 4.44E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | 1.30E-06 | 4.00E-07 | mr1585_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 5.57E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202009958 | NA | 2.81E-14 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |