\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202009958:

Variant ID: vg1202009958 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2009958
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CAGATCTGTAGCCAGCTACGGCACGAACTCCAAGATATAATGTGTGTATGACAAGTGGGACCAGATAATTATAGTATAGTAAACAACTATTATATAAATT[G/A]
GCTATTACATTAATTATAAATGTTTTGGAGCTAATAGTGGACTATACTATTAAACTTGCTCTTACGTTACCGGTAATGACCATGCAAGCACATGGTAGCA

Reverse complement sequence

TGCTACCATGTGCTTGCATGGTCATTACCGGTAACGTAAGAGCAAGTTTAATAGTATAGTCCACTATTAGCTCCAAAACATTTATAATTAATGTAATAGC[C/T]
AATTTATATAATAGTTGTTTACTATACTATAATTATCTGGTCCCACTTGTCATACACACATTATATCTTGGAGTTCGTGCCGTAGCTGGCTACAGATCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 9.30% 0.95% 0.00% NA
All Indica  2759 91.80% 6.60% 1.59% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 7.40% 92.60% 0.00% 0.00% NA
Indica I  595 91.10% 4.70% 4.20% 0.00% NA
Indica II  465 96.30% 2.20% 1.51% 0.00% NA
Indica III  913 90.90% 8.90% 0.22% 0.00% NA
Indica Intermediate  786 90.70% 8.00% 1.27% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202009958 G -> A LOC_Os12g04720.1 downstream_gene_variant ; 247.0bp to feature; MODIFIER silent_mutation Average:63.039; most accessible tissue: Callus, score: 90.027 N N N N
vg1202009958 G -> A LOC_Os12g04740.1 downstream_gene_variant ; 2826.0bp to feature; MODIFIER silent_mutation Average:63.039; most accessible tissue: Callus, score: 90.027 N N N N
vg1202009958 G -> A LOC_Os12g04720.2 downstream_gene_variant ; 247.0bp to feature; MODIFIER silent_mutation Average:63.039; most accessible tissue: Callus, score: 90.027 N N N N
vg1202009958 G -> A LOC_Os12g04740.3 downstream_gene_variant ; 2826.0bp to feature; MODIFIER silent_mutation Average:63.039; most accessible tissue: Callus, score: 90.027 N N N N
vg1202009958 G -> A LOC_Os12g04740.2 downstream_gene_variant ; 2826.0bp to feature; MODIFIER silent_mutation Average:63.039; most accessible tissue: Callus, score: 90.027 N N N N
vg1202009958 G -> A LOC_Os12g04710-LOC_Os12g04720 intergenic_region ; MODIFIER silent_mutation Average:63.039; most accessible tissue: Callus, score: 90.027 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202009958 NA 4.39E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 1.90E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 3.33E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 1.02E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 1.79E-29 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 1.50E-25 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 6.52E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 1.60E-06 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 4.44E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 1.30E-06 4.00E-07 mr1585_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 5.57E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202009958 NA 2.81E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251