Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202007001:

Variant ID: vg1202007001 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2007001
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGGGTGTACTGAGGAATTTACATAGTTGCCCTTATGAAAGGGACGTTTACAGGGTTACATAACGTAAAGGGAGGCTCATGGGCCCTTGATGGGCCATC[A/G]
GGCGATCGCCGGCCCTATGGCCTCTAAGCTTGGTGGGCCGAGAAGGCTACTTCGGCCCTCGCGGGGGCGAACTGGACCTGGCGAAGCCGTCCTTCTCTGG

Reverse complement sequence

CCAGAGAAGGACGGCTTCGCCAGGTCCAGTTCGCCCCCGCGAGGGCCGAAGTAGCCTTCTCGGCCCACCAAGCTTAGAGGCCATAGGGCCGGCGATCGCC[T/C]
GATGGCCCATCAAGGGCCCATGAGCCTCCCTTTACGTTATGTAACCCTGTAAACGTCCCTTTCATAAGGGCAACTATGTAAATTCCTCAGTACACCCTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.50%	35.20%	0.36%	0.00%	NA
All Indica	2759	98.00%	1.40%	0.58%	0.00%	NA
All Japonica	1512	2.60%	97.40%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	96.30%	3.20%	0.43%	0.00%	NA
Indica III	913	99.00%	0.90%	0.11%	0.00%	NA
Indica Intermediate	786	96.60%	1.80%	1.65%	0.00%	NA
Temperate Japonica	767	4.20%	95.80%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	37.80%	61.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202007001	A -> G	LOC_Os12g04720.1	downstream_gene_variant ; 3204.0bp to feature; MODIFIER	silent_mutation	Average:59.401; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg1202007001	A -> G	LOC_Os12g04720.2	downstream_gene_variant ; 3204.0bp to feature; MODIFIER	silent_mutation	Average:59.401; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg1202007001	A -> G	LOC_Os12g04710-LOC_Os12g04720	intergenic_region ; MODIFIER	silent_mutation	Average:59.401; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202007001	NA	6.56E-31	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	8.60E-35	mr1081	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	7.87E-26	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	2.92E-29	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	3.44E-29	mr1256	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	1.42E-15	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	2.31E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	1.69E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	1.60E-35	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	1.89E-31	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	5.10E-68	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	2.73E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	4.48E-39	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	1.82E-24	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	5.34E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	5.25E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	NA	2.81E-47	mr1861_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	2.05E-06	NA	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202007001	1.16E-07	1.16E-07	mr1973_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251