\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201903909:

Variant ID: vg1201903909 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1903909
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTTCGTCTGTCGGTTTGGATTTTGGTTGATATTGGAGATGATGTGACTGAAAAGTTGTGTGTATGACATGTTGATGTGATGAAAAAGTACTGAAGTTT[A/G]
GATCCAAATTTTAGATCTAAACACAGCCTTTGTGTGCAAGTTGGCAGTGGCCTACACTACACATACAGCAGTGCGCATGTCTAGTTGCTTTTCACGGTGC

Reverse complement sequence

GCACCGTGAAAAGCAACTAGACATGCGCACTGCTGTATGTGTAGTGTAGGCCACTGCCAACTTGCACACAAAGGCTGTGTTTAGATCTAAAATTTGGATC[T/C]
AAACTTCAGTACTTTTTCATCACATCAACATGTCATACACACAACTTTTCAGTCACATCATCTCCAATATCAACCAAAATCCAAACCGACAGACGAACTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 24.40% 1.29% 0.00% NA
All Indica  2759 98.60% 1.30% 0.07% 0.00% NA
All Japonica  1512 25.10% 71.20% 3.77% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.40% 0.13% 0.00% NA
Temperate Japonica  767 15.80% 78.70% 5.48% 0.00% NA
Tropical Japonica  504 25.80% 73.80% 0.40% 0.00% NA
Japonica Intermediate  241 53.10% 41.50% 5.39% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201903909 A -> G LOC_Os12g04470.1 upstream_gene_variant ; 951.0bp to feature; MODIFIER silent_mutation Average:78.915; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1201903909 A -> G LOC_Os12g04460.1 downstream_gene_variant ; 3319.0bp to feature; MODIFIER silent_mutation Average:78.915; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1201903909 A -> G LOC_Os12g04480.1 downstream_gene_variant ; 1939.0bp to feature; MODIFIER silent_mutation Average:78.915; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1201903909 A -> G LOC_Os12g04470-LOC_Os12g04480 intergenic_region ; MODIFIER silent_mutation Average:78.915; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1201903909 A G -0.01 -0.01 -0.01 0.0 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201903909 NA 1.91E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 2.13E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 6.98E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 1.98E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 9.21E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 4.30E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 2.56E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 4.80E-09 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 4.69E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 2.54E-06 NA mr1733 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 4.61E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 1.47E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 2.02E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 9.14E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 1.48E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 1.19E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 2.56E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 5.70E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 1.97E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 9.29E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201903909 NA 1.63E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251