\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201779595:

Variant ID: vg1201779595 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1779595
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ACATAGCCCCACGACACGTTTCCGTGCGCCGACATGCCACCACGACATACCGGAAAGAGGCCGTGACAGGACCCTTCGCATAACCCCATCTAACCAAGCA[C/A]
ACCACACCTCAGGTTTCACCCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCGACAGAGGCCGTCGCAGGGCCC

Reverse complement sequence

GGGCCCTGCGACGGCCTCTGTCGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGGTGAAACCTGAGGTGTGGT[G/T]
TGCTTGGTTAGATGGGGTTATGCGAAGGGTCCTGTCACGGCCTCTTTCCGGTATGTCGTGGTGGCATGTCGGCGCACGGAAACGTGTCGTGGGGCTATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 1.40% 19.19% 23.42% NA
All Indica  2759 32.70% 2.10% 27.08% 38.20% NA
All Japonica  1512 97.70% 0.00% 0.40% 1.92% NA
Aus  269 39.00% 3.30% 54.28% 3.35% NA
Indica I  595 32.30% 0.30% 23.53% 43.87% NA
Indica II  465 22.60% 3.90% 20.65% 52.90% NA
Indica III  913 37.30% 2.10% 32.64% 27.93% NA
Indica Intermediate  786 33.50% 2.30% 27.10% 37.15% NA
Temperate Japonica  767 96.10% 0.00% 0.39% 3.52% NA
Tropical Japonica  504 99.20% 0.00% 0.40% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 76.70% 0.00% 8.89% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201779595 C -> DEL N N silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04204.1 upstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04210.1 upstream_gene_variant ; 1892.0bp to feature; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04220.1 upstream_gene_variant ; 3980.0bp to feature; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04204.2 upstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04204.3 upstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04204.4 upstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04204.5 upstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04210.2 upstream_gene_variant ; 1892.0bp to feature; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1201779595 C -> A LOC_Os12g04210-LOC_Os12g04220 intergenic_region ; MODIFIER silent_mutation Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201779595 NA 3.12E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201779595 4.12E-06 NA mr1348 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201779595 NA 8.46E-07 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201779595 NA 2.88E-07 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251