\
| Variant ID: vg1201779595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 1779595 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )
ACATAGCCCCACGACACGTTTCCGTGCGCCGACATGCCACCACGACATACCGGAAAGAGGCCGTGACAGGACCCTTCGCATAACCCCATCTAACCAAGCA[C/A]
ACCACACCTCAGGTTTCACCCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCGACAGAGGCCGTCGCAGGGCCC
GGGCCCTGCGACGGCCTCTGTCGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGGTGAAACCTGAGGTGTGGT[G/T]
TGCTTGGTTAGATGGGGTTATGCGAAGGGTCCTGTCACGGCCTCTTTCCGGTATGTCGTGGTGGCATGTCGGCGCACGGAAACGTGTCGTGGGGCTATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 1.40% | 19.19% | 23.42% | NA |
| All Indica | 2759 | 32.70% | 2.10% | 27.08% | 38.20% | NA |
| All Japonica | 1512 | 97.70% | 0.00% | 0.40% | 1.92% | NA |
| Aus | 269 | 39.00% | 3.30% | 54.28% | 3.35% | NA |
| Indica I | 595 | 32.30% | 0.30% | 23.53% | 43.87% | NA |
| Indica II | 465 | 22.60% | 3.90% | 20.65% | 52.90% | NA |
| Indica III | 913 | 37.30% | 2.10% | 32.64% | 27.93% | NA |
| Indica Intermediate | 786 | 33.50% | 2.30% | 27.10% | 37.15% | NA |
| Temperate Japonica | 767 | 96.10% | 0.00% | 0.39% | 3.52% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 76.70% | 0.00% | 8.89% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1201779595 | C -> DEL | N | N | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04204.1 | upstream_gene_variant ; 4876.0bp to feature; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04210.1 | upstream_gene_variant ; 1892.0bp to feature; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04220.1 | upstream_gene_variant ; 3980.0bp to feature; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04204.2 | upstream_gene_variant ; 4876.0bp to feature; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04204.3 | upstream_gene_variant ; 4876.0bp to feature; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04204.4 | upstream_gene_variant ; 4876.0bp to feature; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04204.5 | upstream_gene_variant ; 4876.0bp to feature; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04210.2 | upstream_gene_variant ; 1892.0bp to feature; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1201779595 | C -> A | LOC_Os12g04210-LOC_Os12g04220 | intergenic_region ; MODIFIER | silent_mutation | Average:16.712; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1201779595 | NA | 3.12E-08 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201779595 | 4.12E-06 | NA | mr1348 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201779595 | NA | 8.46E-07 | mr1892_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201779595 | NA | 2.88E-07 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |