\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201753612:

Variant ID: vg1201753612 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1753612
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GTATATTGAGTGACTAGTAGGTCAGGGTAGTAGAAGAGAAAGGGATTTGCTAGCTTCCTACTCGTACTTAGGGCAAGTTTTATAATAGGGATAGTTGTCA[C/T]
ATCTAATTTTATCCATGTAAGATAAGAGGTGATATATATAATACACCATATCTACACCACCTCTATTATTATAACCCAAATAATTTTATTTTATTTGTTT

Reverse complement sequence

AAACAAATAAAATAAAATTATTTGGGTTATAATAATAGAGGTGGTGTAGATATGGTGTATTATATATATCACCTCTTATCTTACATGGATAAAATTAGAT[G/A]
TGACAACTATCCCTATTATAAAACTTGCCCTAAGTACGAGTAGGAAGCTAGCAAATCCCTTTCTCTTCTACTACCCTGACCTACTAGTCACTCAATATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.50% 0.00% 0.00% NA
All Indica  2759 95.20% 4.80% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 19.00% 81.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 92.20% 7.80% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.60% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201753612 C -> T LOC_Os12g04160.1 upstream_gene_variant ; 3553.0bp to feature; MODIFIER silent_mutation Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974 N N N N
vg1201753612 C -> T LOC_Os12g04180.1 upstream_gene_variant ; 1952.0bp to feature; MODIFIER silent_mutation Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974 N N N N
vg1201753612 C -> T LOC_Os12g04180.4 upstream_gene_variant ; 1963.0bp to feature; MODIFIER silent_mutation Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974 N N N N
vg1201753612 C -> T LOC_Os12g04180.2 upstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974 N N N N
vg1201753612 C -> T LOC_Os12g04180.3 upstream_gene_variant ; 2010.0bp to feature; MODIFIER silent_mutation Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974 N N N N
vg1201753612 C -> T LOC_Os12g04170.1 downstream_gene_variant ; 414.0bp to feature; MODIFIER silent_mutation Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974 N N N N
vg1201753612 C -> T LOC_Os12g04170-LOC_Os12g04180 intergenic_region ; MODIFIER silent_mutation Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201753612 NA 2.05E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 1.75E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 3.24E-24 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 2.14E-27 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 3.92E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 1.09E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 6.29E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 2.19E-22 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 5.78E-08 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 3.62E-08 2.37E-33 mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 4.63E-13 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 1.64E-09 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 1.30E-18 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 5.73E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 1.21E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 9.48E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612 NA 4.19E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251