Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201753612:

Variant ID: vg1201753612 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1753612
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

GTATATTGAGTGACTAGTAGGTCAGGGTAGTAGAAGAGAAAGGGATTTGCTAGCTTCCTACTCGTACTTAGGGCAAGTTTTATAATAGGGATAGTTGTCA[C/T]
ATCTAATTTTATCCATGTAAGATAAGAGGTGATATATATAATACACCATATCTACACCACCTCTATTATTATAACCCAAATAATTTTATTTTATTTGTTT

Reverse complement sequence

AAACAAATAAAATAAAATTATTTGGGTTATAATAATAGAGGTGGTGTAGATATGGTGTATTATATATATCACCTCTTATCTTACATGGATAAAATTAGAT[G/A]
TGACAACTATCCCTATTATAAAACTTGCCCTAAGTACGAGTAGGAAGCTAGCAAATCCCTTTCTCTTCTACTACCCTGACCTACTAGTCACTCAATATAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	7.50%	0.00%	0.00%	NA
All Indica	2759	95.20%	4.80%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	19.00%	81.00%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	92.20%	7.80%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	6.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201753612	C -> T	LOC_Os12g04160.1	upstream_gene_variant ; 3553.0bp to feature; MODIFIER	silent_mutation	Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974	N	N	N	N
vg1201753612	C -> T	LOC_Os12g04180.1	upstream_gene_variant ; 1952.0bp to feature; MODIFIER	silent_mutation	Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974	N	N	N	N
vg1201753612	C -> T	LOC_Os12g04180.4	upstream_gene_variant ; 1963.0bp to feature; MODIFIER	silent_mutation	Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974	N	N	N	N
vg1201753612	C -> T	LOC_Os12g04180.2	upstream_gene_variant ; 2009.0bp to feature; MODIFIER	silent_mutation	Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974	N	N	N	N
vg1201753612	C -> T	LOC_Os12g04180.3	upstream_gene_variant ; 2010.0bp to feature; MODIFIER	silent_mutation	Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974	N	N	N	N
vg1201753612	C -> T	LOC_Os12g04170.1	downstream_gene_variant ; 414.0bp to feature; MODIFIER	silent_mutation	Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974	N	N	N	N
vg1201753612	C -> T	LOC_Os12g04170-LOC_Os12g04180	intergenic_region ; MODIFIER	silent_mutation	Average:61.959; most accessible tissue: Zhenshan97 root, score: 81.974	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201753612	NA	2.05E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	1.75E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	3.24E-24	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	2.14E-27	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	3.92E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	1.09E-12	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	6.29E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	2.19E-22	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	5.78E-08	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	3.62E-08	2.37E-33	mr1586	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	4.63E-13	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	1.64E-09	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	1.30E-18	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	5.73E-13	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	1.21E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	9.48E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201753612	NA	4.19E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251