Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201615762:

Variant ID: vg1201615762 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1615762
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGCGTAATTAGGCTCAAAATATTCGTCTCACAATTTACATGCAAACTGTACAATTGGTTTTTTTCTTCCATATTTAATGCTCCATGCATGTGTTCAAA[T/C]
ATTTGATTTGATAGAAAAGTTAAAAGTATGAAGGTAACTAAACACACAGCCTTGGTAGTTATTTCTTAGAGCTAAAAAATTGGTTTTCTAGCTTTCTACT

Reverse complement sequence

AGTAGAAAGCTAGAAAACCAATTTTTTAGCTCTAAGAAATAACTACCAAGGCTGTGTGTTTAGTTACCTTCATACTTTTAACTTTTCTATCAAATCAAAT[A/G]
TTTGAACACATGCATGGAGCATTAAATATGGAAGAAAAAAACCAATTGTACAGTTTGCATGTAAATTGTGAGACGAATATTTTGAGCCTAATTACGCCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.10%	9.10%	3.83%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.04%	0.00%	NA
All Japonica	1512	61.80%	26.80%	11.38%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	34.00%	48.50%	17.47%	0.00%	NA
Tropical Japonica	504	94.80%	2.40%	2.78%	0.00%	NA
Japonica Intermediate	241	81.30%	8.70%	9.96%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	76.70%	15.60%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201615762	T -> C	LOC_Os12g03899.2	upstream_gene_variant ; 2260.0bp to feature; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N
vg1201615762	T -> C	LOC_Os12g03899.3	upstream_gene_variant ; 2260.0bp to feature; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N
vg1201615762	T -> C	LOC_Os12g03899.1	intron_variant ; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N
vg1201615762	T -> C	LOC_Os12g03899.4	intron_variant ; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201615762	NA	3.10E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1201615762	NA	2.41E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	1.78E-07	7.00E-22	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	6.24E-06	1.32E-10	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	7.76E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	9.65E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	2.17E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	9.58E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	5.18E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	3.31E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	7.51E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	1.21E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762	NA	5.71E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251