\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201615762:

Variant ID: vg1201615762 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1615762
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGCGTAATTAGGCTCAAAATATTCGTCTCACAATTTACATGCAAACTGTACAATTGGTTTTTTTCTTCCATATTTAATGCTCCATGCATGTGTTCAAA[T/C]
ATTTGATTTGATAGAAAAGTTAAAAGTATGAAGGTAACTAAACACACAGCCTTGGTAGTTATTTCTTAGAGCTAAAAAATTGGTTTTCTAGCTTTCTACT

Reverse complement sequence

AGTAGAAAGCTAGAAAACCAATTTTTTAGCTCTAAGAAATAACTACCAAGGCTGTGTGTTTAGTTACCTTCATACTTTTAACTTTTCTATCAAATCAAAT[A/G]
TTTGAACACATGCATGGAGCATTAAATATGGAAGAAAAAAACCAATTGTACAGTTTGCATGTAAATTGTGAGACGAATATTTTGAGCCTAATTACGCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 9.10% 3.83% 0.00% NA
All Indica  2759 99.70% 0.30% 0.04% 0.00% NA
All Japonica  1512 61.80% 26.80% 11.38% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 34.00% 48.50% 17.47% 0.00% NA
Tropical Japonica  504 94.80% 2.40% 2.78% 0.00% NA
Japonica Intermediate  241 81.30% 8.70% 9.96% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 76.70% 15.60% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201615762 T -> C LOC_Os12g03899.2 upstream_gene_variant ; 2260.0bp to feature; MODIFIER silent_mutation Average:41.662; most accessible tissue: Minghui63 root, score: 59.105 N N N N
vg1201615762 T -> C LOC_Os12g03899.3 upstream_gene_variant ; 2260.0bp to feature; MODIFIER silent_mutation Average:41.662; most accessible tissue: Minghui63 root, score: 59.105 N N N N
vg1201615762 T -> C LOC_Os12g03899.1 intron_variant ; MODIFIER silent_mutation Average:41.662; most accessible tissue: Minghui63 root, score: 59.105 N N N N
vg1201615762 T -> C LOC_Os12g03899.4 intron_variant ; MODIFIER silent_mutation Average:41.662; most accessible tissue: Minghui63 root, score: 59.105 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201615762 NA 3.10E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1201615762 NA 2.41E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 1.78E-07 7.00E-22 mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 6.24E-06 1.32E-10 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 7.76E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 9.65E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 2.17E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 9.58E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 5.18E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 3.31E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 7.51E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 1.21E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201615762 NA 5.71E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251