Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1201578984:

Variant ID: vg1201578984 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1578984
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCTCCCAGGAGAAGCCCAAAATTAATGATATCAGCTAAAGACCAAAGGTGGCCCTCAGAGATGATGGACTCAAGGACCTCCGAGACCGATGACAATGCA[G/A]
AGTCGAAAACTCTGGAGTTCCGCTCTTTCCACAGTTGCCAAGAGACTAGGAGGACCATAGAATCGAAACTGGCCCGGAGATGCCCCGGCAAGCAAACCCT

Reverse complement sequence

AGGGTTTGCTTGCCGGGGCATCTCCGGGCCAGTTTCGATTCTATGGTCCTCCTAGTCTCTTGGCAACTGTGGAAAGAGCGGAACTCCAGAGTTTTCGACT[C/T]
TGCATTGTCATCGGTCTCGGAGGTCCTTGAGTCCATCATCTCTGAGGGCCACCTTTGGTCTTTAGCTGATATCATTAATTTTGGGCTTCTCCTGGGAGGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	35.80%	0.25%	0.00%	NA
All Indica	2759	96.90%	2.90%	0.25%	0.00%	NA
All Japonica	1512	2.90%	97.10%	0.00%	0.00%	NA
Aus	269	98.50%	1.10%	0.37%	0.00%	NA
Indica I	595	98.30%	1.20%	0.50%	0.00%	NA
Indica II	465	95.70%	4.10%	0.22%	0.00%	NA
Indica III	913	98.50%	1.40%	0.11%	0.00%	NA
Indica Intermediate	786	94.70%	5.10%	0.25%	0.00%	NA
Temperate Japonica	767	4.60%	95.40%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	32.20%	63.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201578984	G -> A	LOC_Os12g03840.1	downstream_gene_variant ; 4251.0bp to feature; MODIFIER	silent_mutation	Average:32.984; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg1201578984	G -> A	LOC_Os12g03840-LOC_Os12g03860	intergenic_region ; MODIFIER	silent_mutation	Average:32.984; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201578984	NA	9.56E-08	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	6.91E-08	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	1.03E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	6.13E-10	4.68E-12	mr1083	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	6.87E-07	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	6.09E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	1.64E-06	1.01E-10	mr1103	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	8.10E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	1.71E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	1.37E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	9.10E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	5.45E-06	3.12E-08	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	1.05E-06	6.96E-12	mr1226	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	2.89E-06	mr1264	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	3.84E-09	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	2.42E-07	2.50E-11	mr1411	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	9.26E-08	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	7.38E-06	6.55E-10	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	2.65E-08	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	1.49E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	4.14E-07	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	1.01E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	2.63E-08	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	4.41E-07	6.25E-11	mr1973	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	2.68E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	1.31E-18	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	3.70E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201578984	NA	1.63E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251