Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201431377:

Variant ID: vg1201431377 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1431377
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAGTTATCATGTTTTAGAACAGTGGCCTTGTTATAATATTTTGCATACATGCTTAAACCGATTACTTACATTTTATTGGAATCATGTGTGTGAGACAT[A/G]
AGACTTTGGTAATTCATTATTAATCACACTTCAAGTGGCTAAGTGTTTTGATGCTTTGATGATTATTGTTTCAAAAGCCACTTGAATTAGTATTCATCTA

Reverse complement sequence

TAGATGAATACTAATTCAAGTGGCTTTTGAAACAATAATCATCAAAGCATCAAAACACTTAGCCACTTGAAGTGTGATTAATAATGAATTACCAAAGTCT[T/C]
ATGTCTCACACACATGATTCCAATAAAATGTAAGTAATCGGTTTAAGCATGTATGCAAAATATTATAACAAGGCCACTGTTCTAAAACATGATAACTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.30%	36.30%	1.21%	16.25%	NA
All Indica	2759	76.60%	3.40%	1.99%	17.98%	NA
All Japonica	1512	2.70%	97.10%	0.00%	0.20%	NA
Aus	269	1.10%	1.10%	0.00%	97.77%	NA
Indica I	595	83.20%	4.40%	0.84%	11.60%	NA
Indica II	465	94.60%	3.40%	0.00%	1.94%	NA
Indica III	913	65.20%	2.50%	3.83%	28.48%	NA
Indica Intermediate	786	74.30%	3.70%	1.91%	20.10%	NA
Temperate Japonica	767	4.60%	95.30%	0.00%	0.13%	NA
Tropical Japonica	504	1.00%	98.80%	0.00%	0.20%	NA
Japonica Intermediate	241	0.40%	99.20%	0.00%	0.41%	NA
VI/Aromatic	96	2.10%	94.80%	1.04%	2.08%	NA
Intermediate	90	28.90%	65.60%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201431377	A -> DEL	N	N	silent_mutation	Average:32.842; most accessible tissue: Zhenshan97 young leaf, score: 44.598	N	N	N	N
vg1201431377	A -> G	LOC_Os12g03580.1	upstream_gene_variant ; 2512.0bp to feature; MODIFIER	silent_mutation	Average:32.842; most accessible tissue: Zhenshan97 young leaf, score: 44.598	N	N	N	N
vg1201431377	A -> G	LOC_Os12g03570.1	intron_variant ; MODIFIER	silent_mutation	Average:32.842; most accessible tissue: Zhenshan97 young leaf, score: 44.598	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201431377	NA	3.94E-37	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.91E-52	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	3.78E-06	mr1085	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	2.74E-32	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.37E-10	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	5.60E-60	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.66E-09	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	5.52E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	6.31E-08	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	9.73E-10	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	8.04E-45	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	3.79E-45	mr1112	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.99E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	6.18E-36	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	6.16E-34	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	8.68E-11	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	5.71E-29	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.20E-35	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	5.34E-08	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.94E-33	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.88E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	2.18E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.85E-12	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.20E-30	mr1237	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	3.13E-06	mr1241	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.63E-62	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.37E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.50E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	7.21E-17	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.26E-39	mr1404	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	9.43E-07	5.93E-10	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.28E-39	mr1620	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.44E-08	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.25E-33	mr1878	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	2.79E-07	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	8.63E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	4.49E-49	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.36E-06	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	3.81E-18	mr1131_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	7.14E-35	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	1.61E-09	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	4.35E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	7.11E-34	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	6.19E-08	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	5.28E-06	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201431377	NA	4.49E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251