\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201339873:

Variant ID: vg1201339873 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1339873
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAAATTCGGAATTAAAAATAATTAATATTGAAAGAAGTTTCCATATAAGTACCCAATACGAGAATAATCAAAATTCGAAATAAAAATAAAATAAAATC[C/T]
AAAATTAGAAAAGAAAAGGATAATCCAGGTAGGAATATAATTTTAAAATAGCTGAAATTCGGAATTAAAAATAAGAAATATTAAAAGAAGAGTCTATATA

Reverse complement sequence

TATATAGACTCTTCTTTTAATATTTCTTATTTTTAATTCCGAATTTCAGCTATTTTAAAATTATATTCCTACCTGGATTATCCTTTTCTTTTCTAATTTT[G/A]
GATTTTATTTTATTTTTATTTCGAATTTTGATTATTCTCGTATTGGGTACTTATATGGAAACTTCTTTCAATATTAATTATTTTTAATTCCGAATTTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 33.30% 3.22% 8.93% NA
All Indica  2759 25.30% 55.30% 5.00% 14.39% NA
All Japonica  1512 96.20% 1.70% 0.79% 1.26% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 17.80% 50.40% 6.05% 25.71% NA
Indica II  465 8.00% 59.80% 6.45% 25.81% NA
Indica III  913 39.50% 56.80% 1.75% 1.86% NA
Indica Intermediate  786 24.60% 54.70% 7.12% 13.61% NA
Temperate Japonica  767 94.00% 2.20% 1.43% 2.35% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.41% 0.41% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 72.20% 20.00% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201339873 C -> DEL N N silent_mutation Average:25.701; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1201339873 C -> T LOC_Os12g03430.1 upstream_gene_variant ; 366.0bp to feature; MODIFIER silent_mutation Average:25.701; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1201339873 C -> T LOC_Os12g03440.1 upstream_gene_variant ; 2129.0bp to feature; MODIFIER silent_mutation Average:25.701; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1201339873 C -> T LOC_Os12g03430-LOC_Os12g03440 intergenic_region ; MODIFIER silent_mutation Average:25.701; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201339873 NA 1.27E-43 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 7.35E-54 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 3.20E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.68E-57 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 3.73E-09 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.90E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.47E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.26E-44 mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.27E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.51E-42 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.44E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.24E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 5.69E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 9.09E-32 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.02E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.87E-29 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.14E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.31E-20 mr1261 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.94E-07 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.00E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 9.62E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.03E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.85E-51 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.19E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 5.57E-49 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.86E-39 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.07E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.32E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 7.28E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.12E-35 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 5.20E-08 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 2.76E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 8.17E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339873 NA 1.01E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251