\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201339510:

Variant ID: vg1201339510 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1339510
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAGGCCATCGCCATGGGTGGTGCTTGCACTGATGCTGCAACTGCAATGGTGTGAGGAGGAGCTTGGGTTTTGGGTCGCACTGGACTAGGGTTCTACTA[G/C,T]
TAGTTGCAATTTTGGGGAGAAAATGATGAGGTAGACGAAGATGCTAGCAATGGATGATGGGCTTTGCATATTTGGGCTCTCGGCTTCCTTGTTGGGCTCT

Reverse complement sequence

AGAGCCCAACAAGGAAGCCGAGAGCCCAAATATGCAAAGCCCATCATCCATTGCTAGCATCTTCGTCTACCTCATCATTTTCTCCCCAAAATTGCAACTA[C/G,A]
TAGTAGAACCCTAGTCCAGTGCGACCCAAAACCCAAGCTCCTCCTCACACCATTGCAGTTGCAGCATCAGTGCAAGCACCACCCATGGCGATGGCCTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 35.80% 0.78% 0.00% T: 18.24%
All Indica  2759 74.70% 2.80% 1.20% 0.00% T: 21.31%
All Japonica  1512 2.90% 97.00% 0.00% 0.00% T: 0.13%
Aus  269 1.10% 0.70% 0.00% 0.00% T: 98.14%
Indica I  595 82.50% 4.70% 0.17% 0.00% T: 12.61%
Indica II  465 92.50% 2.60% 1.29% 0.00% T: 3.66%
Indica III  913 60.70% 1.60% 0.99% 0.00% T: 36.69%
Indica Intermediate  786 74.60% 2.80% 2.16% 0.00% T: 20.48%
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.60% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 0.80% 98.80% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 3.10% 92.70% 0.00% 0.00% T: 4.17%
Intermediate  90 26.70% 64.40% 4.44% 0.00% T: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201339510 G -> C LOC_Os12g03430.1 upstream_gene_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:88.007; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N
vg1201339510 G -> C LOC_Os12g03440.1 upstream_gene_variant ; 2492.0bp to feature; MODIFIER silent_mutation Average:88.007; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N
vg1201339510 G -> C LOC_Os12g03430-LOC_Os12g03440 intergenic_region ; MODIFIER silent_mutation Average:88.007; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N
vg1201339510 G -> T LOC_Os12g03430.1 upstream_gene_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:88.007; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N
vg1201339510 G -> T LOC_Os12g03440.1 upstream_gene_variant ; 2492.0bp to feature; MODIFIER silent_mutation Average:88.007; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N
vg1201339510 G -> T LOC_Os12g03430-LOC_Os12g03440 intergenic_region ; MODIFIER silent_mutation Average:88.007; most accessible tissue: Zhenshan97 flower, score: 91.937 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1201339510 G C 0.0 0.0 0.01 0.0 0.0 0.0
vg1201339510 G T -0.01 -0.02 0.0 -0.03 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201339510 NA 1.20E-38 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 4.02E-30 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.47E-56 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 8.79E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.64E-14 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 3.19E-29 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 3.68E-63 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.73E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 3.69E-56 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 3.41E-45 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.41E-35 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.42E-33 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 4.86E-32 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 4.37E-80 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.59E-70 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.23E-38 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 5.60E-36 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.89E-41 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.13E-34 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.09E-38 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.16E-40 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.87E-24 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 7.27E-85 mr1246_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.62E-39 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.84E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 1.79E-53 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 5.69E-44 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.58E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 7.25E-48 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.04E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 5.90E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.50E-38 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201339510 NA 2.89E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251