| Variant ID: vg1201300655 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 1300655 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAGTTTCCGCCTTTGCCTCCGCCTTGGTGTCCGCCATCACGAAGGCGAAGGCTCCACCACCGAACTCCTCCCCCTCGCGAACAAGCTAATCCCCCGAAGA[A/C]
ACTTGTACTTCTTGGCCGGCCAAGATCGAACCAATCCTAAATCCCCCCCTAAAAAAGGCGAGAAAATCAGGAATTTGGAGGCGAGAGATTGAAGCTTGGG
CCCAAGCTTCAATCTCTCGCCTCCAAATTCCTGATTTTCTCGCCTTTTTTAGGGGGGGATTTAGGATTGGTTCGATCTTGGCCGGCCAAGAAGTACAAGT[T/G]
TCTTCGGGGGATTAGCTTGTTCGCGAGGGGGAGGAGTTCGGTGGTGGAGCCTTCGCCTTCGTGATGGCGGACACCAAGGCGGAGGCAAAGGCGGAAACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 16.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 81.60% | 18.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 63.20% | 36.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.40% | 17.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1201300655 | A -> C | LOC_Os12g03340.1 | 5_prime_UTR_variant ; 64.0bp to feature; MODIFIER | silent_mutation | Average:75.318; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg1201300655 | A -> C | LOC_Os12g03360.1 | upstream_gene_variant ; 4484.0bp to feature; MODIFIER | silent_mutation | Average:75.318; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg1201300655 | A -> C | LOC_Os12g03350.1 | downstream_gene_variant ; 1685.0bp to feature; MODIFIER | silent_mutation | Average:75.318; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1201300655 | NA | 1.39E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201300655 | 5.63E-06 | NA | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201300655 | 2.26E-08 | 5.73E-11 | mr1261 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201300655 | NA | 1.62E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201300655 | NA | 4.28E-21 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |