Search for Variation information by Variation ID:
Detailed information for vg1201244694:
| Variant ID: vg1201244694 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 1244694 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AACATTAAAAATTAGGGACCATATATCAATGTTCACATAAAGATAAATTTAGATAGGGATGAATCTCAGACCTTAAAGTAAGGATCCCATCTAGGATTTC[T/C]
GGCTATTTTAGTTGGAGTGTCCAATGAGGGGGGGGGGCTGATTAGTTCATCTCGTAGCTCACCGATTGCATGAAGGACTTGGTTCAAATAACGGCTAACT
Reverse complement sequence
AGTTAGCCGTTATTTGAACCAAGTCCTTCATGCAATCGGTGAGCTACGAGATGAACTAATCAGCCCCCCCCCCTCATTGGACACTCCAACTAAAATAGCC[A/G]
GAAATCCTAGATGGGATCCTTACTTTAAGGTCTGAGATTCATCCCTATCTAAATTTATCTTTATGTGAACATTGATATATGGTCCCTAATTTTTAATGTT
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.30% | 18.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 78.10% | 21.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 62.90% | 37.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1201244694 | T -> C | LOC_Os12g03250.1 | missense_variant ; p.Arg189Gly; MODERATE | nonsynonymous_codon ; R189G | Average:31.439; most accessible tissue: Minghui63 panicle, score: 50.413 | probably damaging  |
-2.392 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1201244694 | NA | 3.47E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201244694 | 6.77E-06 | NA | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201244694 | 1.03E-08 | 1.26E-10 | mr1261 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201244694 | NA | 2.40E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201244694 | NA | 1.79E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201244694 | NA | 8.80E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201244694 | NA | 5.06E-20 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |