Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1201238278:

Variant ID: vg1201238278 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1238278
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATATACTCCTTCCGTCCCTAAATATTTAATGCCGTTGACTTTTTTAAACATGTTTGACCATTCGTCTTGTTTAAAAACTTTTGTGAATATTATTAAGAA[A/T]
TTTGAGTAGTAGTAGTATATTTAACAATGAATCAAATGAGAGGAAAATAATTAATAATTACTCATTTTTTAAAATAACATAAACGGTCAAACATATTTAA

Reverse complement sequence

TTAAATATGTTTGACCGTTTATGTTATTTTAAAAAATGAGTAATTATTAATTATTTTCCTCTCATTTGATTCATTGTTAAATATACTACTACTACTCAAA[T/A]
TTCTTAATAATATTCACAAAAGTTTTTAAACAAGACGAATGGTCAAACATGTTTAAAAAAGTCAACGGCATTAAATATTTAGGGACGGAAGGAGTATATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.80%	0.50%	0.66%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.00%	NA
All Japonica	1512	96.70%	1.50%	1.85%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	94.10%	2.30%	3.52%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201238278	A -> T	LOC_Os12g03230.1	upstream_gene_variant ; 806.0bp to feature; MODIFIER	silent_mutation	Average:57.388; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg1201238278	A -> T	LOC_Os12g03240.1	downstream_gene_variant ; 535.0bp to feature; MODIFIER	silent_mutation	Average:57.388; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg1201238278	A -> T	LOC_Os12g03250.1	downstream_gene_variant ; 4090.0bp to feature; MODIFIER	silent_mutation	Average:57.388; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg1201238278	A -> T	LOC_Os12g03230-LOC_Os12g03240	intergenic_region ; MODIFIER	silent_mutation	Average:57.388; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201238278	6.48E-08	6.48E-08	mr1456	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251