Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1201219940:

Variant ID: vg1201219940 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1219940
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAACTAATCAACAATCATACAGCATATCAAAGATTCCATCTTTTTCCCCACTGGTTTCTATCCCATAGAAAATTTTAAAAAACTTAACCGGCAATGTATT[C/T]
TGCTTAGGGAGAAGGATCACAGACCAGTTGTTTTCCCAAGAACGCTGGCAGTGTCAATGACTTTCCTCCTAGCCTCAGGGTTGTTGAATAGCTGACATTG

Reverse complement sequence

CAATGTCAGCTATTCAACAACCCTGAGGCTAGGAGGAAAGTCATTGACACTGCCAGCGTTCTTGGGAAAACAACTGGTCTGTGATCCTTCTCCCTAAGCA[G/A]
AATACATTGCCGGTTAAGTTTTTTAAAATTTTCTATGGGATAGAAACCAGTGGGGAAAAAGATGGAATCTTTGATATGCTGTATGATTGTTGATTAGTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	4.70%	1.12%	0.00%	NA
All Indica	2759	99.20%	0.40%	0.36%	0.00%	NA
All Japonica	1512	86.90%	10.40%	2.65%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	98.90%	0.60%	0.43%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	0.80%	0.76%	0.00%	NA
Temperate Japonica	767	88.50%	7.20%	4.30%	0.00%	NA
Tropical Japonica	504	80.40%	18.70%	0.99%	0.00%	NA
Japonica Intermediate	241	95.40%	3.70%	0.83%	0.00%	NA
VI/Aromatic	96	56.20%	43.80%	0.00%	0.00%	NA
Intermediate	90	92.20%	4.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201219940	C -> T	LOC_Os12g03180.1	upstream_gene_variant ; 3644.0bp to feature; MODIFIER	silent_mutation	Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159	N	N	N	N
vg1201219940	C -> T	LOC_Os12g03200.1	downstream_gene_variant ; 1015.0bp to feature; MODIFIER	silent_mutation	Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159	N	N	N	N
vg1201219940	C -> T	LOC_Os12g03200.2	downstream_gene_variant ; 1014.0bp to feature; MODIFIER	silent_mutation	Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159	N	N	N	N
vg1201219940	C -> T	LOC_Os12g03200.3	downstream_gene_variant ; 1015.0bp to feature; MODIFIER	silent_mutation	Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159	N	N	N	N
vg1201219940	C -> T	LOC_Os12g03190.1	intron_variant ; MODIFIER	silent_mutation	Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201219940	1.04E-06	NA	mr1219	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940	4.31E-06	NA	mr1343	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940	1.50E-06	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940	9.22E-06	NA	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940	3.89E-09	1.56E-08	mr1829_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940	NA	3.81E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940	2.06E-07	NA	mr1842_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940	1.99E-09	NA	mr1902_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940	8.03E-06	7.16E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251