\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201219940:

Variant ID: vg1201219940 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1219940
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACTAATCAACAATCATACAGCATATCAAAGATTCCATCTTTTTCCCCACTGGTTTCTATCCCATAGAAAATTTTAAAAAACTTAACCGGCAATGTATT[C/T]
TGCTTAGGGAGAAGGATCACAGACCAGTTGTTTTCCCAAGAACGCTGGCAGTGTCAATGACTTTCCTCCTAGCCTCAGGGTTGTTGAATAGCTGACATTG

Reverse complement sequence

CAATGTCAGCTATTCAACAACCCTGAGGCTAGGAGGAAAGTCATTGACACTGCCAGCGTTCTTGGGAAAACAACTGGTCTGTGATCCTTCTCCCTAAGCA[G/A]
AATACATTGCCGGTTAAGTTTTTTAAAATTTTCTATGGGATAGAAACCAGTGGGGAAAAAGATGGAATCTTTGATATGCTGTATGATTGTTGATTAGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 4.70% 1.12% 0.00% NA
All Indica  2759 99.20% 0.40% 0.36% 0.00% NA
All Japonica  1512 86.90% 10.40% 2.65% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 0.80% 0.76% 0.00% NA
Temperate Japonica  767 88.50% 7.20% 4.30% 0.00% NA
Tropical Japonica  504 80.40% 18.70% 0.99% 0.00% NA
Japonica Intermediate  241 95.40% 3.70% 0.83% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201219940 C -> T LOC_Os12g03180.1 upstream_gene_variant ; 3644.0bp to feature; MODIFIER silent_mutation Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 N N N N
vg1201219940 C -> T LOC_Os12g03200.1 downstream_gene_variant ; 1015.0bp to feature; MODIFIER silent_mutation Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 N N N N
vg1201219940 C -> T LOC_Os12g03200.2 downstream_gene_variant ; 1014.0bp to feature; MODIFIER silent_mutation Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 N N N N
vg1201219940 C -> T LOC_Os12g03200.3 downstream_gene_variant ; 1015.0bp to feature; MODIFIER silent_mutation Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 N N N N
vg1201219940 C -> T LOC_Os12g03190.1 intron_variant ; MODIFIER silent_mutation Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201219940 1.04E-06 NA mr1219 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940 4.31E-06 NA mr1343 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940 1.50E-06 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940 9.22E-06 NA mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940 3.89E-09 1.56E-08 mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940 NA 3.81E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940 2.06E-07 NA mr1842_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940 1.99E-09 NA mr1902_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201219940 8.03E-06 7.16E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251