\
| Variant ID: vg1201219940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 1219940 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAACTAATCAACAATCATACAGCATATCAAAGATTCCATCTTTTTCCCCACTGGTTTCTATCCCATAGAAAATTTTAAAAAACTTAACCGGCAATGTATT[C/T]
TGCTTAGGGAGAAGGATCACAGACCAGTTGTTTTCCCAAGAACGCTGGCAGTGTCAATGACTTTCCTCCTAGCCTCAGGGTTGTTGAATAGCTGACATTG
CAATGTCAGCTATTCAACAACCCTGAGGCTAGGAGGAAAGTCATTGACACTGCCAGCGTTCTTGGGAAAACAACTGGTCTGTGATCCTTCTCCCTAAGCA[G/A]
AATACATTGCCGGTTAAGTTTTTTAAAATTTTCTATGGGATAGAAACCAGTGGGGAAAAAGATGGAATCTTTGATATGCTGTATGATTGTTGATTAGTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 4.70% | 1.12% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.40% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 86.90% | 10.40% | 2.65% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 0.80% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 88.50% | 7.20% | 4.30% | 0.00% | NA |
| Tropical Japonica | 504 | 80.40% | 18.70% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 4.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1201219940 | C -> T | LOC_Os12g03180.1 | upstream_gene_variant ; 3644.0bp to feature; MODIFIER | silent_mutation | Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 | N | N | N | N |
| vg1201219940 | C -> T | LOC_Os12g03200.1 | downstream_gene_variant ; 1015.0bp to feature; MODIFIER | silent_mutation | Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 | N | N | N | N |
| vg1201219940 | C -> T | LOC_Os12g03200.2 | downstream_gene_variant ; 1014.0bp to feature; MODIFIER | silent_mutation | Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 | N | N | N | N |
| vg1201219940 | C -> T | LOC_Os12g03200.3 | downstream_gene_variant ; 1015.0bp to feature; MODIFIER | silent_mutation | Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 | N | N | N | N |
| vg1201219940 | C -> T | LOC_Os12g03190.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.599; most accessible tissue: Zhenshan97 flower, score: 80.159 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1201219940 | 1.04E-06 | NA | mr1219 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201219940 | 4.31E-06 | NA | mr1343 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201219940 | 1.50E-06 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201219940 | 9.22E-06 | NA | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201219940 | 3.89E-09 | 1.56E-08 | mr1829_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201219940 | NA | 3.81E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201219940 | 2.06E-07 | NA | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201219940 | 1.99E-09 | NA | mr1902_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201219940 | 8.03E-06 | 7.16E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |