\
| Variant ID: vg1201024139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 1024139 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCATAATAGGTGACATTTTTGACTTTTTATTTGCAACATTTGACCATTCGTTTTATTTGAAAAATTAGTGCAAATATTAAAAAAAAGATAAGTCATATGT[A/G]
AAGTAATTTTGATAATAAAGCAATTGACAAACAAAATAAATAATAATTTCAAAATTTTTTAAATAAGACGAATGATCAAACATTGACAAACAAAAAAAAC
GTTTTTTTTGTTTGTCAATGTTTGATCATTCGTCTTATTTAAAAAATTTTGAAATTATTATTTATTTTGTTTGTCAATTGCTTTATTATCAAAATTACTT[T/C]
ACATATGACTTATCTTTTTTTTAATATTTGCACTAATTTTTCAAATAAAACGAATGGTCAAATGTTGCAAATAAAAAGTCAAAAATGTCACCTATTATGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1201024139 | A -> G | LOC_Os12g02840.1 | downstream_gene_variant ; 2963.0bp to feature; MODIFIER | silent_mutation | Average:51.253; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg1201024139 | A -> G | LOC_Os12g02840-LOC_Os12g02850 | intergenic_region ; MODIFIER | silent_mutation | Average:51.253; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1201024139 | NA | 3.16E-15 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | 1.61E-07 | NA | mr1261 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | NA | 9.59E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | NA | 3.53E-11 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | NA | 3.76E-10 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | NA | 8.08E-24 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | NA | 4.70E-29 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | NA | 2.06E-24 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | NA | 3.21E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201024139 | NA | 9.88E-16 | mr1911_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |