\
| Variant ID: vg1200948719 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 948719 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 236. )
GAATCATCATCGTTACTGGATAGTTCTGTTGTAACATCACTCAGTCGTCTTGCCATTGCTTCCTGCAGTAACACAACAATGTGATGATGGTAGGGAAGGG[C/T]
ATGTCCATGAGTCAAATTCAAAGATTACAAACTAGCTGCCATTGTATCTGGAAAGAAAATAAATAACAGTGTTTTCAATTCTCTCTTTCCTCAATAAACT
AGTTTATTGAGGAAAGAGAGAATTGAAAACACTGTTATTTATTTTCTTTCCAGATACAATGGCAGCTAGTTTGTAATCTTTGAATTTGACTCATGGACAT[G/A]
CCCTTCCCTACCATCATCACATTGTTGTGTTACTGCAGGAAGCAATGGCAAGACGACTGAGTGATGTTACAACAGAACTATCCAGTAACGATGATGATTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 38.30% | 0.06% | 0.21% | NA |
| All Indica | 2759 | 46.30% | 53.30% | 0.07% | 0.29% | NA |
| All Japonica | 1512 | 96.50% | 3.40% | 0.00% | 0.07% | NA |
| Aus | 269 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 11.80% | 87.70% | 0.00% | 0.43% | NA |
| Indica III | 913 | 49.00% | 50.80% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 41.60% | 57.60% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 27.80% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200948719 | C -> DEL | N | N | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg1200948719 | C -> T | LOC_Os12g02700.1 | upstream_gene_variant ; 3172.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg1200948719 | C -> T | LOC_Os12g02690.1 | downstream_gene_variant ; 4661.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg1200948719 | C -> T | LOC_Os12g02690.3 | downstream_gene_variant ; 4661.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg1200948719 | C -> T | LOC_Os12g02690.2 | downstream_gene_variant ; 4661.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg1200948719 | C -> T | LOC_Os12g02690.4 | downstream_gene_variant ; 4661.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg1200948719 | C -> T | LOC_Os12g02710.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200948719 | NA | 9.27E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 1.88E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 4.02E-08 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 1.04E-22 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 2.44E-09 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 1.69E-07 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 2.47E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 2.79E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 5.15E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 3.79E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 2.43E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 4.56E-09 | mr1944 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 3.64E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200948719 | NA | 1.12E-17 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |