\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200948719:

Variant ID: vg1200948719 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 948719
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCATCATCGTTACTGGATAGTTCTGTTGTAACATCACTCAGTCGTCTTGCCATTGCTTCCTGCAGTAACACAACAATGTGATGATGGTAGGGAAGGG[C/T]
ATGTCCATGAGTCAAATTCAAAGATTACAAACTAGCTGCCATTGTATCTGGAAAGAAAATAAATAACAGTGTTTTCAATTCTCTCTTTCCTCAATAAACT

Reverse complement sequence

AGTTTATTGAGGAAAGAGAGAATTGAAAACACTGTTATTTATTTTCTTTCCAGATACAATGGCAGCTAGTTTGTAATCTTTGAATTTGACTCATGGACAT[G/A]
CCCTTCCCTACCATCATCACATTGTTGTGTTACTGCAGGAAGCAATGGCAAGACGACTGAGTGATGTTACAACAGAACTATCCAGTAACGATGATGATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.30% 0.06% 0.21% NA
All Indica  2759 46.30% 53.30% 0.07% 0.29% NA
All Japonica  1512 96.50% 3.40% 0.00% 0.07% NA
Aus  269 3.00% 97.00% 0.00% 0.00% NA
Indica I  595 75.50% 24.50% 0.00% 0.00% NA
Indica II  465 11.80% 87.70% 0.00% 0.43% NA
Indica III  913 49.00% 50.80% 0.00% 0.22% NA
Indica Intermediate  786 41.60% 57.60% 0.25% 0.51% NA
Temperate Japonica  767 95.20% 4.80% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.20% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 70.00% 27.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200948719 C -> DEL N N silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 N N N N
vg1200948719 C -> T LOC_Os12g02700.1 upstream_gene_variant ; 3172.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 N N N N
vg1200948719 C -> T LOC_Os12g02690.1 downstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 N N N N
vg1200948719 C -> T LOC_Os12g02690.3 downstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 N N N N
vg1200948719 C -> T LOC_Os12g02690.2 downstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 N N N N
vg1200948719 C -> T LOC_Os12g02690.4 downstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 N N N N
vg1200948719 C -> T LOC_Os12g02710.1 intron_variant ; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200948719 NA 9.27E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 1.88E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 4.02E-08 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 1.04E-22 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 2.44E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 1.69E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 2.47E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 2.79E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 5.15E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 3.79E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 2.43E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 4.56E-09 mr1944 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 3.64E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719 NA 1.12E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251