Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200917000:

Variant ID: vg1200917000 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 917000
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAATTTATCTAAACAAAACTGATAAAAAGCGTTTGTCACACTTTTCTTCACCAATTTGAACTAGCTAATGGTGATATGTGCATATTTTTATTTGTTTT[G/A]
AAGGATATTTGCTTGAGTGTATTTTGGAAGTTTGTGACAAATGGAATATTTGGAAGTTTCTAATGAATGGTATACTCGTGATAATATTGTAGGCAATAAC

Reverse complement sequence

GTTATTGCCTACAATATTATCACGAGTATACCATTCATTAGAAACTTCCAAATATTCCATTTGTCACAAACTTCCAAAATACACTCAAGCAAATATCCTT[C/T]
AAAACAAATAAAAATATGCACATATCACCATTAGCTAGTTCAAATTGGTGAAGAAAAGTGTGACAAACGCTTTTTATCAGTTTTGTTTAGATAAATTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.50%	0.50%	0.76%	0.28%	NA
All Indica	2759	99.40%	0.00%	0.11%	0.47%	NA
All Japonica	1512	96.40%	1.50%	2.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.50%	0.00%	0.33%	1.20%	NA
Indica Intermediate	786	99.70%	0.00%	0.00%	0.25%	NA
Temperate Japonica	767	93.00%	2.90%	4.17%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200917000	G -> DEL	N	N	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02630.1	downstream_gene_variant ; 4604.0bp to feature; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02640.1	downstream_gene_variant ; 469.0bp to feature; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02660.1	downstream_gene_variant ; 4618.0bp to feature; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02660.5	downstream_gene_variant ; 351.0bp to feature; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02660.4	downstream_gene_variant ; 4618.0bp to feature; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02660.6	downstream_gene_variant ; 4618.0bp to feature; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02660.7	downstream_gene_variant ; 4618.0bp to feature; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02660.8	downstream_gene_variant ; 4618.0bp to feature; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1200917000	G -> A	LOC_Os12g02660.2	intron_variant ; MODIFIER	silent_mutation	Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200917000	NA	2.96E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	9.01E-06	9.01E-06	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	NA	2.81E-09	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	NA	9.08E-09	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	NA	1.56E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	NA	7.34E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	NA	8.48E-08	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	NA	2.87E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	3.46E-08	3.46E-08	mr1430_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000	NA	3.44E-08	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251