\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200917000:

Variant ID: vg1200917000 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 917000
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAATTTATCTAAACAAAACTGATAAAAAGCGTTTGTCACACTTTTCTTCACCAATTTGAACTAGCTAATGGTGATATGTGCATATTTTTATTTGTTTT[G/A]
AAGGATATTTGCTTGAGTGTATTTTGGAAGTTTGTGACAAATGGAATATTTGGAAGTTTCTAATGAATGGTATACTCGTGATAATATTGTAGGCAATAAC

Reverse complement sequence

GTTATTGCCTACAATATTATCACGAGTATACCATTCATTAGAAACTTCCAAATATTCCATTTGTCACAAACTTCCAAAATACACTCAAGCAAATATCCTT[C/T]
AAAACAAATAAAAATATGCACATATCACCATTAGCTAGTTCAAATTGGTGAAGAAAAGTGTGACAAACGCTTTTTATCAGTTTTGTTTAGATAAATTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.50% 0.50% 0.76% 0.28% NA
All Indica  2759 99.40% 0.00% 0.11% 0.47% NA
All Japonica  1512 96.40% 1.50% 2.12% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.50% 0.00% 0.33% 1.20% NA
Indica Intermediate  786 99.70% 0.00% 0.00% 0.25% NA
Temperate Japonica  767 93.00% 2.90% 4.17% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200917000 G -> DEL N N silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02630.1 downstream_gene_variant ; 4604.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02640.1 downstream_gene_variant ; 469.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02660.1 downstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02660.5 downstream_gene_variant ; 351.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02660.4 downstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02660.6 downstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02660.7 downstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02660.8 downstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1200917000 G -> A LOC_Os12g02660.2 intron_variant ; MODIFIER silent_mutation Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200917000 NA 2.96E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 9.01E-06 9.01E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 NA 2.81E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 NA 9.08E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 NA 1.56E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 NA 7.34E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 NA 8.48E-08 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 NA 2.87E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 3.46E-08 3.46E-08 mr1430_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200917000 NA 3.44E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251