\
| Variant ID: vg1200917000 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 917000 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
GTCAATTTATCTAAACAAAACTGATAAAAAGCGTTTGTCACACTTTTCTTCACCAATTTGAACTAGCTAATGGTGATATGTGCATATTTTTATTTGTTTT[G/A]
AAGGATATTTGCTTGAGTGTATTTTGGAAGTTTGTGACAAATGGAATATTTGGAAGTTTCTAATGAATGGTATACTCGTGATAATATTGTAGGCAATAAC
GTTATTGCCTACAATATTATCACGAGTATACCATTCATTAGAAACTTCCAAATATTCCATTTGTCACAAACTTCCAAAATACACTCAAGCAAATATCCTT[C/T]
AAAACAAATAAAAATATGCACATATCACCATTAGCTAGTTCAAATTGGTGAAGAAAAGTGTGACAAACGCTTTTTATCAGTTTTGTTTAGATAAATTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.50% | 0.50% | 0.76% | 0.28% | NA |
| All Indica | 2759 | 99.40% | 0.00% | 0.11% | 0.47% | NA |
| All Japonica | 1512 | 96.40% | 1.50% | 2.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 0.00% | 0.33% | 1.20% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 93.00% | 2.90% | 4.17% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200917000 | G -> DEL | N | N | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02630.1 | downstream_gene_variant ; 4604.0bp to feature; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02640.1 | downstream_gene_variant ; 469.0bp to feature; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02660.1 | downstream_gene_variant ; 4618.0bp to feature; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02660.5 | downstream_gene_variant ; 351.0bp to feature; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02660.4 | downstream_gene_variant ; 4618.0bp to feature; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02660.6 | downstream_gene_variant ; 4618.0bp to feature; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02660.7 | downstream_gene_variant ; 4618.0bp to feature; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02660.8 | downstream_gene_variant ; 4618.0bp to feature; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1200917000 | G -> A | LOC_Os12g02660.2 | intron_variant ; MODIFIER | silent_mutation | Average:55.588; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200917000 | NA | 2.96E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | 9.01E-06 | 9.01E-06 | mr1166 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | NA | 2.81E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | NA | 9.08E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | NA | 1.56E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | NA | 7.34E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | NA | 8.48E-08 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | NA | 2.87E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | 3.46E-08 | 3.46E-08 | mr1430_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200917000 | NA | 3.44E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |