\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200902440:

Variant ID: vg1200902440 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 902440
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTGTTCTCCATAGGATGGCCCATGGCTAGCCCCCATAGAAGGATGTCGCACAGAGACGCCGACGTCACCTATGATGCCACCGACCAACTTAATCTCAC[T/C]
ACAGGTAGTGACGGCGGCGGCAACGTCCCAGCAGCTAGACCTGTCGCCACTAGCCTCGGCCCTGCTAGCTGTAACGCCCCGATTTTCGTTCGGGATTAAA

Reverse complement sequence

TTTAATCCCGAACGAAAATCGGGGCGTTACAGCTAGCAGGGCCGAGGCTAGTGGCGACAGGTCTAGCTGCTGGGACGTTGCCGCCGCCGTCACTACCTGT[A/G]
GTGAGATTAAGTTGGTCGGTGGCATCATAGGTGACGTCGGCGTCTCTGTGCGACATCCTTCTATGGGGGCTAGCCATGGGCCATCCTATGGAGAACAGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 21.50% 0.06% 0.32% NA
All Indica  2759 63.30% 36.00% 0.11% 0.54% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 53.30% 46.70% 0.00% 0.00% NA
Indica II  465 91.40% 8.60% 0.00% 0.00% NA
Indica III  913 53.90% 44.70% 0.22% 1.20% NA
Indica Intermediate  786 65.30% 34.10% 0.13% 0.51% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200902440 T -> C LOC_Os12g02610.1 upstream_gene_variant ; 2336.0bp to feature; MODIFIER silent_mutation Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1200902440 T -> C LOC_Os12g02620.1 upstream_gene_variant ; 3882.0bp to feature; MODIFIER silent_mutation Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1200902440 T -> C LOC_Os12g02589.1 downstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1200902440 T -> C LOC_Os12g02589.2 downstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1200902440 T -> C LOC_Os12g02589.3 downstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1200902440 T -> C LOC_Os12g02660.2 downstream_gene_variant ; 4392.0bp to feature; MODIFIER silent_mutation Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1200902440 T -> C LOC_Os12g02610-LOC_Os12g02620 intergenic_region ; MODIFIER silent_mutation Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1200902440 T -> DEL N N silent_mutation Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200902440 NA 2.41E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200902440 1.45E-06 NA mr1598 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200902440 8.62E-06 8.69E-08 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200902440 NA 4.08E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251