Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200902440:

Variant ID: vg1200902440 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 902440
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTGTTCTCCATAGGATGGCCCATGGCTAGCCCCCATAGAAGGATGTCGCACAGAGACGCCGACGTCACCTATGATGCCACCGACCAACTTAATCTCAC[T/C]
ACAGGTAGTGACGGCGGCGGCAACGTCCCAGCAGCTAGACCTGTCGCCACTAGCCTCGGCCCTGCTAGCTGTAACGCCCCGATTTTCGTTCGGGATTAAA

Reverse complement sequence

TTTAATCCCGAACGAAAATCGGGGCGTTACAGCTAGCAGGGCCGAGGCTAGTGGCGACAGGTCTAGCTGCTGGGACGTTGCCGCCGCCGTCACTACCTGT[A/G]
GTGAGATTAAGTTGGTCGGTGGCATCATAGGTGACGTCGGCGTCTCTGTGCGACATCCTTCTATGGGGGCTAGCCATGGGCCATCCTATGGAGAACAGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	21.50%	0.06%	0.32%	NA
All Indica	2759	63.30%	36.00%	0.11%	0.54%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	53.30%	46.70%	0.00%	0.00%	NA
Indica II	465	91.40%	8.60%	0.00%	0.00%	NA
Indica III	913	53.90%	44.70%	0.22%	1.20%	NA
Indica Intermediate	786	65.30%	34.10%	0.13%	0.51%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200902440	T -> C	LOC_Os12g02610.1	upstream_gene_variant ; 2336.0bp to feature; MODIFIER	silent_mutation	Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg1200902440	T -> C	LOC_Os12g02620.1	upstream_gene_variant ; 3882.0bp to feature; MODIFIER	silent_mutation	Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg1200902440	T -> C	LOC_Os12g02589.1	downstream_gene_variant ; 3988.0bp to feature; MODIFIER	silent_mutation	Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg1200902440	T -> C	LOC_Os12g02589.2	downstream_gene_variant ; 3988.0bp to feature; MODIFIER	silent_mutation	Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg1200902440	T -> C	LOC_Os12g02589.3	downstream_gene_variant ; 3988.0bp to feature; MODIFIER	silent_mutation	Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg1200902440	T -> C	LOC_Os12g02660.2	downstream_gene_variant ; 4392.0bp to feature; MODIFIER	silent_mutation	Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg1200902440	T -> C	LOC_Os12g02610-LOC_Os12g02620	intergenic_region ; MODIFIER	silent_mutation	Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg1200902440	T -> DEL	N	N	silent_mutation	Average:62.173; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200902440	NA	2.41E-08	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200902440	1.45E-06	NA	mr1598	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200902440	8.62E-06	8.69E-08	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200902440	NA	4.08E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251