Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200841195:

Variant ID: vg1200841195 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 841195
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTATATATATTTTTCGTGTGGGCTGAAGTCTGTGGCTGACGTGTTACTGTGTGCATGCATATGTGTCAATATCAATATGTCATGACAAGAATATATAA[C/T]
TAATGTTCACATGGAAATTATTTGCGTCCGATGGATATTTTGCCATCTGTCTATATGGTTAATTAATAAGGAAGACTAGAAAGCTGAAAACAATTTATGA

Reverse complement sequence

TCATAAATTGTTTTCAGCTTTCTAGTCTTCCTTATTAATTAACCATATAGACAGATGGCAAAATATCCATCGGACGCAAATAATTTCCATGTGAACATTA[G/A]
TTATATATTCTTGTCATGACATATTGATATTGACACATATGCATGCACACAGTAACACGTCAGCCACAGACTTCAGCCCACACGAAAAATATATATAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 49.80% 0.06% 0.00% NA
All Indica  2759 81.70% 18.20% 0.07% 0.00% NA
All Japonica  1512 4.30% 95.70% 0.00% 0.00% NA
Aus  269 4.50% 95.50% 0.00% 0.00% NA
Indica I  595 64.00% 35.80% 0.17% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 88.40% 11.50% 0.11% 0.00% NA
Indica Intermediate  786 79.30% 20.70% 0.00% 0.00% NA
Temperate Japonica  767 6.00% 94.00% 0.00% 0.00% NA
Tropical Japonica  504 3.00% 97.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200841195 C -> T LOC_Os12g02470.1 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:79.095; most accessible tissue: Minghui63 young leaf, score: 93.025 N N N N
vg1200841195 C -> T LOC_Os12g02490.1 downstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:79.095; most accessible tissue: Minghui63 young leaf, score: 93.025 N N N N
vg1200841195 C -> T LOC_Os12g02470-LOC_Os12g02490 intergenic_region ; MODIFIER silent_mutation Average:79.095; most accessible tissue: Minghui63 young leaf, score: 93.025 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1200841195 C T 0.07 0.12 0.11 -0.02 0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200841195 NA 1.77E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 6.03E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 8.71E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 7.98E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 2.20E-30 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 9.64E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 4.21E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 2.48E-06 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 2.79E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 1.40E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 5.77E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 1.13E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 1.70E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 6.20E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 5.48E-22 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 5.50E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 8.06E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 2.50E-08 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 1.02E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 8.88E-22 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200841195 NA 2.98E-12 mr1758_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251