\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200840948:

Variant ID: vg1200840948 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 840948
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCAAATATTTAAATTATTGCATTAGATGGAGCTCCATCTAAAAAACCAATGTCCGAAGATAAATCTAGACAAGTCATTGCAGAAGTTGATTTTTTTTTT[C/T]
TGGGATGAAGGAGTAGACAGTAGTAGAAGTAATAATATTTGAGAGTATTCCTTCTATAATATTTTTGAATAATTTGAATAGTAGTCGGTTCACTAATTTT

Reverse complement sequence

AAAATTAGTGAACCGACTACTATTCAAATTATTCAAAAATATTATAGAAGGAATACTCTCAAATATTATTACTTCTACTACTGTCTACTCCTTCATCCCA[G/A]
AAAAAAAAAATCAACTTCTGCAATGACTTGTCTAGATTTATCTTCGGACATTGGTTTTTTAGATGGAGCTCCATCTAATGCAATAATTTAAATATTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.30% 1.30% 0.38% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 94.80% 4.10% 1.12% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 91.70% 6.30% 2.09% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200840948 C -> T LOC_Os12g02470.1 upstream_gene_variant ; 2193.0bp to feature; MODIFIER silent_mutation Average:55.738; most accessible tissue: Callus, score: 84.701 N N N N
vg1200840948 C -> T LOC_Os12g02490.1 downstream_gene_variant ; 3250.0bp to feature; MODIFIER silent_mutation Average:55.738; most accessible tissue: Callus, score: 84.701 N N N N
vg1200840948 C -> T LOC_Os12g02470-LOC_Os12g02490 intergenic_region ; MODIFIER silent_mutation Average:55.738; most accessible tissue: Callus, score: 84.701 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200840948 NA 3.92E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 NA 5.96E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 1.74E-07 1.74E-07 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 NA 6.18E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 NA 2.55E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 NA 1.53E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 2.64E-07 1.86E-11 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 NA 2.65E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 NA 3.82E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 6.80E-07 1.38E-14 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200840948 NA 1.72E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251