\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200839145:

Variant ID: vg1200839145 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 839145
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCTGGTGTCTGCAGGCAGCTGCATGTATTATATTAGTTCATGCGCTAATTAGCTAACTTCTCCATAATATATGGTGGTGTTTGAATCTCCTGAAGTTG[A/G]
AGATAAAAATTAAGTACGTTTCATACAAAATGAGGTGGTAATAATGTGTGATTAATTGAGTTTTAATTATTAAAAACTTAAAAAATTGATTAATCTGATA

Reverse complement sequence

TATCAGATTAATCAATTTTTTAAGTTTTTAATAATTAAAACTCAATTAATCACACATTATTACCACCTCATTTTGTATGAAACGTACTTAATTTTTATCT[T/C]
CAACTTCAGGAGATTCAAACACCACCATATATTATGGAGAAGTTAGCTAATTAGCGCATGAACTAATATAATACATGCAGCTGCCTGCAGACACCAGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 49.50% 0.11% 0.23% NA
All Indica  2759 18.60% 80.90% 0.18% 0.33% NA
All Japonica  1512 95.80% 4.20% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 35.80% 64.00% 0.17% 0.00% NA
Indica II  465 4.70% 94.80% 0.00% 0.43% NA
Indica III  913 12.60% 87.10% 0.11% 0.22% NA
Indica Intermediate  786 20.90% 78.10% 0.38% 0.64% NA
Temperate Japonica  767 94.00% 6.00% 0.00% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 68.90% 28.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200839145 A -> DEL N N silent_mutation Average:65.327; most accessible tissue: Zhenshan97 flower, score: 86.118 N N N N
vg1200839145 A -> G LOC_Os12g02470.1 upstream_gene_variant ; 390.0bp to feature; MODIFIER silent_mutation Average:65.327; most accessible tissue: Zhenshan97 flower, score: 86.118 N N N N
vg1200839145 A -> G LOC_Os12g02470-LOC_Os12g02490 intergenic_region ; MODIFIER silent_mutation Average:65.327; most accessible tissue: Zhenshan97 flower, score: 86.118 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200839145 9.22E-06 1.24E-32 mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 2.66E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 8.17E-06 NA mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 2.93E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 5.90E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 1.77E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 3.03E-28 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 1.11E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 7.15E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 7.90E-07 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 3.67E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 1.25E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 3.89E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 1.04E-06 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 7.71E-10 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 1.99E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 1.07E-21 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 1.94E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 4.82E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 4.51E-09 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 4.29E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200839145 NA 2.15E-11 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251