\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200773837:

Variant ID: vg1200773837 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 773837
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CATTATAATGTTTAATTACTATGTTGTGCTGTTGTATGTGTCACGAATTATAATTTAATGTGACTATATCATTCCGATTTCTAAAGTTTCTTTGACGCCA[T/C]
GATATGTTGTATCCTTATAATTTATATGTACCTGCTTATATTTTTATAACTTCCACCTTCAATTGTGTACATGATTCAACATACATGACAATTATGCGTA

Reverse complement sequence

TACGCATAATTGTCATGTATGTTGAATCATGTACACAATTGAAGGTGGAAGTTATAAAAATATAAGCAGGTACATATAAATTATAAGGATACAACATATC[A/G]
TGGCGTCAAAGAAACTTTAGAAATCGGAATGATATAGTCACATTAAATTATAATTCGTGACACATACAACAGCACAACATAGTAATTAAACATTATAATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 28.70% 1.61% 30.19% NA
All Indica  2759 9.90% 38.30% 2.65% 49.15% NA
All Japonica  1512 95.60% 1.20% 0.07% 3.17% NA
Aus  269 2.60% 95.90% 0.37% 1.12% NA
Indica I  595 29.60% 58.70% 0.67% 11.09% NA
Indica II  465 3.40% 8.80% 0.86% 86.88% NA
Indica III  913 3.40% 39.60% 4.49% 52.46% NA
Indica Intermediate  786 6.20% 38.90% 3.05% 51.78% NA
Temperate Japonica  767 94.00% 1.40% 0.13% 4.43% NA
Tropical Japonica  504 96.80% 1.00% 0.00% 2.18% NA
Japonica Intermediate  241 97.90% 0.80% 0.00% 1.24% NA
VI/Aromatic  96 91.70% 6.20% 0.00% 2.08% NA
Intermediate  90 63.30% 15.60% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200773837 T -> C LOC_Os12g02380.1 upstream_gene_variant ; 2756.0bp to feature; MODIFIER silent_mutation Average:10.165; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg1200773837 T -> C LOC_Os12g02370-LOC_Os12g02380 intergenic_region ; MODIFIER silent_mutation Average:10.165; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg1200773837 T -> DEL N N silent_mutation Average:10.165; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200773837 NA 1.12E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 1.89E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 3.37E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 6.51E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 1.64E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 1.98E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 7.41E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 1.29E-22 mr1767 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 2.13E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 1.73E-22 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 5.82E-23 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 1.28E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 1.08E-16 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 6.91E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 7.57E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200773837 NA 1.17E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251