\
| Variant ID: vg1200672282 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 672282 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTGTTGTTGGGCGTCTTCATCTTCACTGCTAGCTGACCTAACTGCTGCCGACTGGTTTCTTCGCCTCCATGGCTATGCGACTTCATCATCTTTGATTGGT[G/A]
TCACCGTTTTTACCACCACCAACATTTTTGTCACCTCTGACGGGCGATATCATCCCCATGTTCATCATCTTGCCTTCATGTCGACTGCATCAGCTATTGC
GCAATAGCTGATGCAGTCGACATGAAGGCAAGATGATGAACATGGGGATGATATCGCCCGTCAGAGGTGACAAAAATGTTGGTGGTGGTAAAAACGGTGA[C/T]
ACCAATCAAAGATGATGAAGTCGCATAGCCATGGAGGCGAAGAAACCAGTCGGCAGCAGTTAGGTCAGCTAGCAGTGAAGATGAAGACGCCCAACAACAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.40% | 44.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 4.00% | 95.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.10% | 25.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200672282 | G -> A | LOC_Os12g02180.1 | downstream_gene_variant ; 1800.0bp to feature; MODIFIER | silent_mutation | Average:22.657; most accessible tissue: Callus, score: 47.846 | N | N | N | N |
| vg1200672282 | G -> A | LOC_Os12g02170-LOC_Os12g02180 | intergenic_region ; MODIFIER | silent_mutation | Average:22.657; most accessible tissue: Callus, score: 47.846 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200672282 | NA | 3.27E-12 | mr1172_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200672282 | NA | 4.33E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200672282 | NA | 2.39E-06 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200672282 | NA | 1.63E-11 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200672282 | NA | 3.44E-06 | mr1449_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200672282 | NA | 1.60E-12 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200672282 | NA | 1.38E-11 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200672282 | NA | 4.22E-10 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200672282 | NA | 6.52E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |