\
| Variant ID: vg1200639944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 639944 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 309. )
AACATAAATATCAGTAAACTTAAACATCCGCAGTCAACCTCTGAACATGCATACATCACATTTGGCGATGATATGATGAATTTTCACTTTCAGCAATAGT[A/T]
TGTGTTTCACTTTCAACAGCAATAGCCGTACACATGAGCAAAGTGACAGTCTCAAGACGGCCTTATTCGATACTCTGAATTTACAAGGCACTATGTGCGT
ACGCACATAGTGCCTTGTAAATTCAGAGTATCGAATAAGGCCGTCTTGAGACTGTCACTTTGCTCATGTGTACGGCTATTGCTGTTGAAAGTGAAACACA[T/A]
ACTATTGCTGAAAGTGAAAATTCATCATATCATCGCCAAATGTGATGTATGCATGTTCAGAGGTTGACTGCGGATGTTTAAGTTTACTGATATTTATGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 5.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.10% | 69.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200639944 | A -> T | LOC_Os12g02120.1 | 3_prime_UTR_variant ; 477.0bp to feature; MODIFIER | silent_mutation | Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 | N | N | N | N |
| vg1200639944 | A -> T | LOC_Os12g02120.2 | 3_prime_UTR_variant ; 477.0bp to feature; MODIFIER | silent_mutation | Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 | N | N | N | N |
| vg1200639944 | A -> T | LOC_Os12g02100.1 | downstream_gene_variant ; 1914.0bp to feature; MODIFIER | silent_mutation | Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 | N | N | N | N |
| vg1200639944 | A -> T | LOC_Os12g02105.1 | downstream_gene_variant ; 712.0bp to feature; MODIFIER | silent_mutation | Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 | N | N | N | N |
| vg1200639944 | A -> T | LOC_Os12g02100.2 | downstream_gene_variant ; 1914.0bp to feature; MODIFIER | silent_mutation | Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200639944 | NA | 1.28E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 3.42E-16 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 3.86E-06 | mr1153 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 2.05E-13 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | 1.63E-06 | NA | mr1208 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 5.48E-07 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 3.84E-09 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 1.75E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 2.93E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 2.09E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200639944 | NA | 5.13E-12 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |