\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200639944:

Variant ID: vg1200639944 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 639944
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


AACATAAATATCAGTAAACTTAAACATCCGCAGTCAACCTCTGAACATGCATACATCACATTTGGCGATGATATGATGAATTTTCACTTTCAGCAATAGT[A/T]
TGTGTTTCACTTTCAACAGCAATAGCCGTACACATGAGCAAAGTGACAGTCTCAAGACGGCCTTATTCGATACTCTGAATTTACAAGGCACTATGTGCGT

Reverse complement sequence

ACGCACATAGTGCCTTGTAAATTCAGAGTATCGAATAAGGCCGTCTTGAGACTGTCACTTTGCTCATGTGTACGGCTATTGCTGTTGAAAGTGAAACACA[T/A]
ACTATTGCTGAAAGTGAAAATTCATCATATCATCGCCAAATGTGATGTATGCATGTTCAGAGGTTGACTGCGGATGTTTAAGTTTACTGATATTTATGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 5.00% 0.06% 0.00% NA
All Indica  2759 98.30% 1.70% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 30.10% 69.10% 0.74% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.80% 2.10% 0.11% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200639944 A -> T LOC_Os12g02120.1 3_prime_UTR_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg1200639944 A -> T LOC_Os12g02120.2 3_prime_UTR_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg1200639944 A -> T LOC_Os12g02100.1 downstream_gene_variant ; 1914.0bp to feature; MODIFIER silent_mutation Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg1200639944 A -> T LOC_Os12g02105.1 downstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg1200639944 A -> T LOC_Os12g02100.2 downstream_gene_variant ; 1914.0bp to feature; MODIFIER silent_mutation Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200639944 NA 1.28E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 3.42E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 3.86E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 2.05E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 1.63E-06 NA mr1208 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 5.48E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 3.84E-09 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 1.75E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 2.93E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 2.09E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944 NA 5.13E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251