\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200595732:

Variant ID: vg1200595732 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 595732
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTAATCAGATAACCAGCACTAACAATGCCATCTTTTGTGGTCTCCTCCCTAACCCTGCTGGCTGGCTGTTTCCTTCAAGTTGGAAGTTAGTCGTCATG[G/A]
TCACGTACCACTTGTAATCTTAGAGTGGTCAGACGTCTGTAAACTCTATCCGGCTGCAGGTACATCTCAAGGAAGAAGATCGAAACAACTCGAGCCCATG

Reverse complement sequence

CATGGGCTCGAGTTGTTTCGATCTTCTTCCTTGAGATGTACCTGCAGCCGGATAGAGTTTACAGACGTCTGACCACTCTAAGATTACAAGTGGTACGTGA[C/T]
CATGACGACTAACTTCCAACTTGAAGGAAACAGCCAGCCAGCAGGGTTAGGGAGGAGACCACAAAAGATGGCATTGTTAGTGCTGGTTATCTGATTAACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 31.80% 0.21% 0.68% NA
All Indica  2759 81.80% 16.80% 0.29% 1.12% NA
All Japonica  1512 44.00% 55.90% 0.07% 0.07% NA
Aus  269 42.00% 58.00% 0.00% 0.00% NA
Indica I  595 85.90% 13.10% 0.34% 0.67% NA
Indica II  465 93.50% 2.80% 0.43% 3.23% NA
Indica III  913 77.50% 21.50% 0.11% 0.88% NA
Indica Intermediate  786 76.60% 22.50% 0.38% 0.51% NA
Temperate Japonica  767 10.70% 89.00% 0.13% 0.13% NA
Tropical Japonica  504 90.90% 9.10% 0.00% 0.00% NA
Japonica Intermediate  241 51.90% 48.10% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200595732 G -> DEL N N silent_mutation Average:71.422; most accessible tissue: Zhenshan97 root, score: 93.669 N N N N
vg1200595732 G -> A LOC_Os12g02020.1 upstream_gene_variant ; 3972.0bp to feature; MODIFIER silent_mutation Average:71.422; most accessible tissue: Zhenshan97 root, score: 93.669 N N N N
vg1200595732 G -> A LOC_Os12g02010.1 downstream_gene_variant ; 1384.0bp to feature; MODIFIER silent_mutation Average:71.422; most accessible tissue: Zhenshan97 root, score: 93.669 N N N N
vg1200595732 G -> A LOC_Os12g02010-LOC_Os12g02020 intergenic_region ; MODIFIER silent_mutation Average:71.422; most accessible tissue: Zhenshan97 root, score: 93.669 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1200595732 G A -0.02 -0.02 -0.02 -0.03 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200595732 NA 9.59E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200595732 NA 7.45E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200595732 NA 1.06E-12 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200595732 NA 5.34E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200595732 7.86E-07 6.12E-06 mr1842 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251