Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200586913:

Variant ID: vg1200586913 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 586913
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTTGGAATCCGTTTAGATTTTGGATTCCCTAAGTTTTTAGTTATAGTTTGATTCAGTTCAGTCTAGGGTGTTTTGTTACTAGTCCATTGTTTGCAAAC[G/A]
ACCAGATTCGATGGTGTTCTATGTTTTTTTTCTAATCCACGAGGGTTTTTGTATTTTTGGTTCGATTTTTCTTCAGGGGTGTTCATGTTGGGGGTTGGAT

Reverse complement sequence

ATCCAACCCCCAACATGAACACCCCTGAAGAAAAATCGAACCAAAAATACAAAAACCCTCGTGGATTAGAAAAAAAACATAGAACACCATCGAATCTGGT[C/T]
GTTTGCAAACAATGGACTAGTAACAAAACACCCTAGACTGAACTGAATCAAACTATAACTAAAAACTTAGGGAATCCAAAATCTAAACGGATTCCAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.30%	12.70%	12.08%	54.91%	NA
All Indica	2759	2.20%	0.70%	7.29%	89.85%	NA
All Japonica	1512	57.30%	32.20%	6.68%	3.84%	NA
Aus	269	0.70%	4.50%	86.99%	7.81%	NA
Indica I	595	2.90%	0.20%	3.70%	93.28%	NA
Indica II	465	1.10%	0.60%	4.73%	93.55%	NA
Indica III	913	1.00%	0.90%	7.34%	90.80%	NA
Indica Intermediate	786	3.80%	0.80%	11.45%	83.97%	NA
Temperate Japonica	767	89.30%	3.50%	1.96%	5.22%	NA
Tropical Japonica	504	11.90%	72.40%	13.10%	2.58%	NA
Japonica Intermediate	241	50.20%	39.40%	8.30%	2.07%	NA
VI/Aromatic	96	10.40%	65.60%	19.79%	4.17%	NA
Intermediate	90	24.40%	21.10%	17.78%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200586913	G -> DEL	N	N	silent_mutation	Average:9.138; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N
vg1200586913	G -> A	LOC_Os12g01990.1	upstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:9.138; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N
vg1200586913	G -> A	LOC_Os12g02000.1	downstream_gene_variant ; 1220.0bp to feature; MODIFIER	silent_mutation	Average:9.138; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N
vg1200586913	G -> A	LOC_Os12g02000-LOC_Os12g02010	intergenic_region ; MODIFIER	silent_mutation	Average:9.138; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200586913	NA	8.04E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200586913	1.63E-06	1.63E-06	mr1663	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200586913	NA	3.15E-07	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251