\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200586913:

Variant ID: vg1200586913 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 586913
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGGAATCCGTTTAGATTTTGGATTCCCTAAGTTTTTAGTTATAGTTTGATTCAGTTCAGTCTAGGGTGTTTTGTTACTAGTCCATTGTTTGCAAAC[G/A]
ACCAGATTCGATGGTGTTCTATGTTTTTTTTCTAATCCACGAGGGTTTTTGTATTTTTGGTTCGATTTTTCTTCAGGGGTGTTCATGTTGGGGGTTGGAT

Reverse complement sequence

ATCCAACCCCCAACATGAACACCCCTGAAGAAAAATCGAACCAAAAATACAAAAACCCTCGTGGATTAGAAAAAAAACATAGAACACCATCGAATCTGGT[C/T]
GTTTGCAAACAATGGACTAGTAACAAAACACCCTAGACTGAACTGAATCAAACTATAACTAAAAACTTAGGGAATCCAAAATCTAAACGGATTCCAAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.30% 12.70% 12.08% 54.91% NA
All Indica  2759 2.20% 0.70% 7.29% 89.85% NA
All Japonica  1512 57.30% 32.20% 6.68% 3.84% NA
Aus  269 0.70% 4.50% 86.99% 7.81% NA
Indica I  595 2.90% 0.20% 3.70% 93.28% NA
Indica II  465 1.10% 0.60% 4.73% 93.55% NA
Indica III  913 1.00% 0.90% 7.34% 90.80% NA
Indica Intermediate  786 3.80% 0.80% 11.45% 83.97% NA
Temperate Japonica  767 89.30% 3.50% 1.96% 5.22% NA
Tropical Japonica  504 11.90% 72.40% 13.10% 2.58% NA
Japonica Intermediate  241 50.20% 39.40% 8.30% 2.07% NA
VI/Aromatic  96 10.40% 65.60% 19.79% 4.17% NA
Intermediate  90 24.40% 21.10% 17.78% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200586913 G -> DEL N N silent_mutation Average:9.138; most accessible tissue: Minghui63 root, score: 19.68 N N N N
vg1200586913 G -> A LOC_Os12g01990.1 upstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:9.138; most accessible tissue: Minghui63 root, score: 19.68 N N N N
vg1200586913 G -> A LOC_Os12g02000.1 downstream_gene_variant ; 1220.0bp to feature; MODIFIER silent_mutation Average:9.138; most accessible tissue: Minghui63 root, score: 19.68 N N N N
vg1200586913 G -> A LOC_Os12g02000-LOC_Os12g02010 intergenic_region ; MODIFIER silent_mutation Average:9.138; most accessible tissue: Minghui63 root, score: 19.68 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200586913 NA 8.04E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200586913 1.63E-06 1.63E-06 mr1663 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200586913 NA 3.15E-07 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251