\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200551570:

Variant ID: vg1200551570 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 551570
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATCTCCTAGAATAAAGGTATGAACAATAAGTTCACACGACTATAGCTTATATAATCTCTCCACGTCATACATGGATGGTATATAGATAACTTACGCAA[A/T]
ATACTATATGTAGTATAATTAACAATTTAGTTAATCAACAAATGTAATCCTTCTCTCTCTTATTTTTCTTACATCCACATAGTTAAAAGCCCTACATGAC

Reverse complement sequence

GTCATGTAGGGCTTTTAACTATGTGGATGTAAGAAAAATAAGAGAGAGAAGGATTACATTTGTTGATTAACTAAATTGTTAATTATACTACATATAGTAT[T/A]
TTGCGTAAGTTATCTATATACCATCCATGTATGACGTGGAGAGATTATATAAGCTATAGTCGTGTGAACTTATTGTTCATACCTTTATTCTAGGAGATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 36.20% 0.02% 0.00% NA
All Indica  2759 97.80% 2.20% 0.04% 0.00% NA
All Japonica  1512 4.40% 95.60% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 97.70% 2.20% 0.11% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 6.40% 93.60% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200551570 A -> T LOC_Os12g01922.1 upstream_gene_variant ; 1075.0bp to feature; MODIFIER silent_mutation Average:53.327; most accessible tissue: Callus, score: 76.873 N N N N
vg1200551570 A -> T LOC_Os12g01930.1 downstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:53.327; most accessible tissue: Callus, score: 76.873 N N N N
vg1200551570 A -> T LOC_Os12g01930.4 downstream_gene_variant ; 2868.0bp to feature; MODIFIER silent_mutation Average:53.327; most accessible tissue: Callus, score: 76.873 N N N N
vg1200551570 A -> T LOC_Os12g01930.2 downstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:53.327; most accessible tissue: Callus, score: 76.873 N N N N
vg1200551570 A -> T LOC_Os12g01930.3 downstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:53.327; most accessible tissue: Callus, score: 76.873 N N N N
vg1200551570 A -> T LOC_Os12g01930.5 downstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:53.327; most accessible tissue: Callus, score: 76.873 N N N N
vg1200551570 A -> T LOC_Os12g01922-LOC_Os12g01930 intergenic_region ; MODIFIER silent_mutation Average:53.327; most accessible tissue: Callus, score: 76.873 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200551570 4.98E-07 NA mr1120 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 4.03E-17 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 1.89E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 3.43E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 3.27E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 2.22E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 1.93E-24 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 2.60E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 3.50E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 2.72E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 5.52E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 2.76E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 1.91E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 5.37E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 3.79E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 7.41E-35 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 1.87E-32 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 1.23E-67 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 1.44E-36 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 1.61E-41 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570 NA 4.50E-36 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251