Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200551570:

Variant ID: vg1200551570 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 551570
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATCTCCTAGAATAAAGGTATGAACAATAAGTTCACACGACTATAGCTTATATAATCTCTCCACGTCATACATGGATGGTATATAGATAACTTACGCAA[A/T]
ATACTATATGTAGTATAATTAACAATTTAGTTAATCAACAAATGTAATCCTTCTCTCTCTTATTTTTCTTACATCCACATAGTTAAAAGCCCTACATGAC

Reverse complement sequence

GTCATGTAGGGCTTTTAACTATGTGGATGTAAGAAAAATAAGAGAGAGAAGGATTACATTTGTTGATTAACTAAATTGTTAATTATACTACATATAGTAT[T/A]
TTGCGTAAGTTATCTATATACCATCCATGTATGACGTGGAGAGATTATATAAGCTATAGTCGTGTGAACTTATTGTTCATACCTTTATTCTAGGAGATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.80%	36.20%	0.02%	0.00%	NA
All Indica	2759	97.80%	2.20%	0.04%	0.00%	NA
All Japonica	1512	4.40%	95.60%	0.00%	0.00%	NA
Aus	269	76.20%	23.80%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	97.70%	2.20%	0.11%	0.00%	NA
Indica Intermediate	786	96.90%	3.10%	0.00%	0.00%	NA
Temperate Japonica	767	6.40%	93.60%	0.00%	0.00%	NA
Tropical Japonica	504	2.60%	97.40%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200551570	A -> T	LOC_Os12g01922.1	upstream_gene_variant ; 1075.0bp to feature; MODIFIER	silent_mutation	Average:53.327; most accessible tissue: Callus, score: 76.873	N	N	N	N
vg1200551570	A -> T	LOC_Os12g01930.1	downstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:53.327; most accessible tissue: Callus, score: 76.873	N	N	N	N
vg1200551570	A -> T	LOC_Os12g01930.4	downstream_gene_variant ; 2868.0bp to feature; MODIFIER	silent_mutation	Average:53.327; most accessible tissue: Callus, score: 76.873	N	N	N	N
vg1200551570	A -> T	LOC_Os12g01930.2	downstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:53.327; most accessible tissue: Callus, score: 76.873	N	N	N	N
vg1200551570	A -> T	LOC_Os12g01930.3	downstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:53.327; most accessible tissue: Callus, score: 76.873	N	N	N	N
vg1200551570	A -> T	LOC_Os12g01930.5	downstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:53.327; most accessible tissue: Callus, score: 76.873	N	N	N	N
vg1200551570	A -> T	LOC_Os12g01922-LOC_Os12g01930	intergenic_region ; MODIFIER	silent_mutation	Average:53.327; most accessible tissue: Callus, score: 76.873	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200551570	4.98E-07	NA	mr1120	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	4.03E-17	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	1.89E-28	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	3.43E-15	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	3.27E-07	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	2.22E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	1.93E-24	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	2.60E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	3.50E-20	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	2.72E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	5.52E-09	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	2.76E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	1.91E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	5.37E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	3.79E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	7.41E-35	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	1.87E-32	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	1.23E-67	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	1.44E-36	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	1.61E-41	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200551570	NA	4.50E-36	mr1878_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251