\
| Variant ID: vg1200546779 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 546779 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 236. )
ACAATTTGCGGACCGCATGATTCTCTCAGCAAGTAAGAAGTTGCGAAAGAGACTAGCAACCAAAAGATCCTGCCTGAAAAGTCTTTGGAATAGATCTGCG[C/T]
AGTGAAAGTTGAATCATAACAGATTAAAAGAAAATGAATGAGAAAGCAATTGATCACTGGCATTAATTGTAACTAAAACGACTATCAGTACCATGAGGAA
TTCCTCATGGTACTGATAGTCGTTTTAGTTACAATTAATGCCAGTGATCAATTGCTTTCTCATTCATTTTCTTTTAATCTGTTATGATTCAACTTTCACT[G/A]
CGCAGATCTATTCCAAAGACTTTTCAGGCAGGATCTTTTGGTTGCTAGTCTCTTTCGCAACTTCTTACTTGCTGAGAGAATCATGCGGTCCGCAAATTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.20% | 9.90% | 48.20% | 4.76% | NA |
| All Indica | 2759 | 3.50% | 15.90% | 73.29% | 7.25% | NA |
| All Japonica | 1512 | 95.70% | 0.50% | 3.24% | 0.60% | NA |
| Aus | 269 | 24.50% | 5.20% | 65.06% | 5.20% | NA |
| Indica I | 595 | 2.20% | 14.10% | 77.14% | 6.55% | NA |
| Indica II | 465 | 3.70% | 9.70% | 73.98% | 12.69% | NA |
| Indica III | 913 | 3.50% | 19.50% | 71.96% | 5.04% | NA |
| Indica Intermediate | 786 | 4.50% | 16.90% | 71.50% | 7.12% | NA |
| Temperate Japonica | 767 | 93.90% | 0.70% | 4.82% | 0.65% | NA |
| Tropical Japonica | 504 | 97.40% | 0.20% | 1.79% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.40% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 5.60% | 27.78% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200546779 | C -> DEL | N | N | silent_mutation | Average:29.008; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg1200546779 | C -> T | LOC_Os12g01922.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:29.008; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200546779 | 6.67E-06 | NA | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | NA | 1.31E-16 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | NA | 5.35E-28 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | NA | 7.45E-15 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | NA | 3.35E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | NA | 1.27E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | NA | 1.60E-19 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | NA | 1.27E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | 1.28E-06 | NA | mr1858 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200546779 | 1.24E-06 | NA | mr1859 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |