\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200474744:

Variant ID: vg1200474744 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 474744
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TAATGTAGCTTTACTGACAAAGAAATAACAAACCAGAATTTCTGTCTCTAGTGATTTCCATACCTAGAATTTTCTTAGCAACACCAAGATCCTTCATATC[A/G]
AACTCACTACTCAACTGTTTCTTCAATGCAGTGATTTGTTCCTTGCTCTTGGCAGCAATCAGCATATCATCAACATATAACAGCAAGTATATAGGTGATC

Reverse complement sequence

GATCACCTATATACTTGCTGTTATATGTTGATGATATGCTGATTGCTGCCAAGAGCAAGGAACAAATCACTGCATTGAAGAAACAGTTGAGTAGTGAGTT[T/C]
GATATGAAGGATCTTGGTGTTGCTAAGAAAATTCTAGGTATGGAAATCACTAGAGACAGAAATTCTGGTTTGTTATTTCTTTGTCAGTAAAGCTACATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 24.40% 20.23% 2.33% NA
All Indica  2759 27.40% 40.40% 29.07% 3.04% NA
All Japonica  1512 96.20% 1.30% 0.93% 1.59% NA
Aus  269 50.90% 1.10% 47.96% 0.00% NA
Indica I  595 46.90% 15.50% 35.63% 2.02% NA
Indica II  465 21.10% 49.50% 18.28% 11.18% NA
Indica III  913 18.50% 53.70% 26.83% 0.99% NA
Indica Intermediate  786 26.80% 38.70% 33.08% 1.40% NA
Temperate Japonica  767 94.70% 1.20% 1.04% 3.13% NA
Tropical Japonica  504 97.60% 1.80% 0.60% 0.00% NA
Japonica Intermediate  241 97.90% 0.80% 1.24% 0.00% NA
VI/Aromatic  96 94.80% 1.00% 4.17% 0.00% NA
Intermediate  90 74.40% 15.60% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200474744 A -> DEL LOC_Os12g01780.1 N frameshift_variant Average:16.941; most accessible tissue: Callus, score: 29.867 N N N N
vg1200474744 A -> G LOC_Os12g01780.1 synonymous_variant ; p.Phe925Phe; LOW synonymous_codon Average:16.941; most accessible tissue: Callus, score: 29.867 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200474744 NA 8.19E-06 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 NA 4.22E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 1.94E-06 1.94E-06 mr1162 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 NA 1.04E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 NA 7.64E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 NA 5.58E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 NA 1.24E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 NA 3.88E-06 mr1614 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 NA 3.02E-07 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 7.95E-06 1.16E-06 mr1713 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200474744 NA 9.01E-06 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251