Variant ID: vg1200363040 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 363040 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCGGTAACTGCCGATGCACACTATAGCCGATGCGGTTTCGAAGCCGATTCGTACCCTGTTTCCGTTATTGATTTCCTTGCAAATCCGCTTCGGCGTTAA[C/T]
TCCAAATCTGATGGATGATTTACCAAATTTCGTTGTTAACACCGGGGTAGTGCGCCTGCGCACTGCTACATGTTAGGCGACATGCCGCCTGACATCCCCT
AGGGGATGTCAGGCGGCATGTCGCCTAACATGTAGCAGTGCGCAGGCGCACTACCCCGGTGTTAACAACGAAATTTGGTAAATCATCCATCAGATTTGGA[G/A]
TTAACGCCGAAGCGGATTTGCAAGGAAATCAATAACGGAAACAGGGTACGAATCGGCTTCGAAACCGCATCGGCTATAGTGTGCATCGGCAGTTACCGAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.70% | 1.90% | 0.34% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 93.10% | 6.00% | 0.93% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 97.50% | 1.40% | 1.04% | 0.00% | NA |
Tropical Japonica | 504 | 97.00% | 2.80% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 71.00% | 27.00% | 2.07% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1200363040 | C -> T | LOC_Os12g01590.1 | upstream_gene_variant ; 3679.0bp to feature; MODIFIER | silent_mutation | Average:59.584; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
vg1200363040 | C -> T | LOC_Os12g01610.1 | upstream_gene_variant ; 3317.0bp to feature; MODIFIER | silent_mutation | Average:59.584; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
vg1200363040 | C -> T | LOC_Os12g01600.1 | downstream_gene_variant ; 1199.0bp to feature; MODIFIER | silent_mutation | Average:59.584; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
vg1200363040 | C -> T | LOC_Os12g01590-LOC_Os12g01600 | intergenic_region ; MODIFIER | silent_mutation | Average:59.584; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1200363040 | NA | 7.65E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200363040 | 3.84E-06 | 4.81E-08 | mr1691 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200363040 | NA | 6.50E-08 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200363040 | NA | 9.08E-06 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200363040 | NA | 2.72E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200363040 | NA | 1.15E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |