\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200292611:

Variant ID: vg1200292611 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 292611
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCATAAAGTAATTTAGCATAAAATGGAAGTAAATTGTTACAATATTAAAAGCAAATTCGTCGTAGAGAGAAAAATATGGTCTATCTAAAAATTAAAT[T/A]
AAAGTCCACAAATTATAGAATTGACTAAAAACAATAATAAAAATAATCAACTTAGAGCATTATGAATGTATAAGAAGTAATTTAATCAAATCGAAAAGTA

Reverse complement sequence

TACTTTTCGATTTGATTAAATTACTTCTTATACATTCATAATGCTCTAAGTTGATTATTTTTATTATTGTTTTTAGTCAATTCTATAATTTGTGGACTTT[A/T]
ATTTAATTTTTAGATAGACCATATTTTTCTCTCTACGACGAATTTGCTTTTAATATTGTAACAATTTACTTCCATTTTATGCTAAATTACTTTATGATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 16.70% 0.34% 0.32% NA
All Indica  2759 70.70% 28.20% 0.54% 0.54% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 50.30% 49.10% 0.67% 0.00% NA
Indica II  465 93.10% 6.20% 0.22% 0.43% NA
Indica III  913 69.30% 29.50% 0.33% 0.88% NA
Indica Intermediate  786 74.60% 23.90% 0.89% 0.64% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200292611 T -> DEL N N silent_mutation Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 N N N N
vg1200292611 T -> A LOC_Os12g01480.1 upstream_gene_variant ; 1098.0bp to feature; MODIFIER silent_mutation Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 N N N N
vg1200292611 T -> A LOC_Os12g01470.1 downstream_gene_variant ; 4604.0bp to feature; MODIFIER silent_mutation Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 N N N N
vg1200292611 T -> A LOC_Os12g01490.1 downstream_gene_variant ; 4005.0bp to feature; MODIFIER silent_mutation Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 N N N N
vg1200292611 T -> A LOC_Os12g01480-LOC_Os12g01490 intergenic_region ; MODIFIER silent_mutation Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200292611 NA 5.52E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200292611 NA 2.75E-07 mr1729 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251