\
| Variant ID: vg1200292611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 292611 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 122. )
AAATCATAAAGTAATTTAGCATAAAATGGAAGTAAATTGTTACAATATTAAAAGCAAATTCGTCGTAGAGAGAAAAATATGGTCTATCTAAAAATTAAAT[T/A]
AAAGTCCACAAATTATAGAATTGACTAAAAACAATAATAAAAATAATCAACTTAGAGCATTATGAATGTATAAGAAGTAATTTAATCAAATCGAAAAGTA
TACTTTTCGATTTGATTAAATTACTTCTTATACATTCATAATGCTCTAAGTTGATTATTTTTATTATTGTTTTTAGTCAATTCTATAATTTGTGGACTTT[A/T]
ATTTAATTTTTAGATAGACCATATTTTTCTCTCTACGACGAATTTGCTTTTAATATTGTAACAATTTACTTCCATTTTATGCTAAATTACTTTATGATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.70% | 16.70% | 0.34% | 0.32% | NA |
| All Indica | 2759 | 70.70% | 28.20% | 0.54% | 0.54% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.30% | 49.10% | 0.67% | 0.00% | NA |
| Indica II | 465 | 93.10% | 6.20% | 0.22% | 0.43% | NA |
| Indica III | 913 | 69.30% | 29.50% | 0.33% | 0.88% | NA |
| Indica Intermediate | 786 | 74.60% | 23.90% | 0.89% | 0.64% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200292611 | T -> DEL | N | N | silent_mutation | Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 | N | N | N | N |
| vg1200292611 | T -> A | LOC_Os12g01480.1 | upstream_gene_variant ; 1098.0bp to feature; MODIFIER | silent_mutation | Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 | N | N | N | N |
| vg1200292611 | T -> A | LOC_Os12g01470.1 | downstream_gene_variant ; 4604.0bp to feature; MODIFIER | silent_mutation | Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 | N | N | N | N |
| vg1200292611 | T -> A | LOC_Os12g01490.1 | downstream_gene_variant ; 4005.0bp to feature; MODIFIER | silent_mutation | Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 | N | N | N | N |
| vg1200292611 | T -> A | LOC_Os12g01480-LOC_Os12g01490 | intergenic_region ; MODIFIER | silent_mutation | Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200292611 | NA | 5.52E-07 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200292611 | NA | 2.75E-07 | mr1729 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |