\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200200887:

Variant ID: vg1200200887 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 200887
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, G: 0.27, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAATGTAAAGGGCAGATTTAACATGCCAATCAAGCATATAATATATAAAGTAGTTAAATCAGGTAAGATCGGCTGAAACCCCGATGCTACCCTAATCG[A/G]
CAACCAGAAAACAGGCTAGAGATTGAGATTCTAAGCACGACATAGTAGATCAAACTTAACTGATGTAGCATTAAGTATGAAAAGAAGAACAATATCTAGA

Reverse complement sequence

TCTAGATATTGTTCTTCTTTTCATACTTAATGCTACATCAGTTAAGTTTGATCTACTATGTCGTGCTTAGAATCTCAATCTCTAGCCTGTTTTCTGGTTG[T/C]
CGATTAGGGTAGCATCGGGGTTTCAGCCGATCTTACCTGATTTAACTACTTTATATATTATATGCTTGATTGGCATGTTAAATCTGCCCTTTACATTAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.00% 11.40% 1.33% 40.25% NA
All Indica  2759 17.80% 14.00% 2.07% 66.18% NA
All Japonica  1512 96.00% 0.30% 0.13% 3.57% NA
Aus  269 48.70% 49.80% 1.12% 0.37% NA
Indica I  595 18.00% 23.50% 1.85% 56.64% NA
Indica II  465 12.30% 0.60% 1.94% 85.16% NA
Indica III  913 18.90% 12.40% 2.30% 66.37% NA
Indica Intermediate  786 19.60% 16.40% 2.04% 61.96% NA
Temperate Japonica  767 94.70% 0.00% 0.13% 5.22% NA
Tropical Japonica  504 97.20% 0.40% 0.20% 2.18% NA
Japonica Intermediate  241 97.90% 0.80% 0.00% 1.24% NA
VI/Aromatic  96 92.70% 5.20% 0.00% 2.08% NA
Intermediate  90 65.60% 12.20% 1.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200200887 A -> DEL N N silent_mutation Average:8.985; most accessible tissue: Callus, score: 21.61 N N N N
vg1200200887 A -> G LOC_Os12g01350.1 upstream_gene_variant ; 3589.0bp to feature; MODIFIER silent_mutation Average:8.985; most accessible tissue: Callus, score: 21.61 N N N N
vg1200200887 A -> G LOC_Os12g01340-LOC_Os12g01350 intergenic_region ; MODIFIER silent_mutation Average:8.985; most accessible tissue: Callus, score: 21.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200200887 NA 6.57E-10 mr1066 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 7.10E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 5.74E-07 5.74E-07 mr1468 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 2.86E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 5.62E-09 mr1543 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 7.17E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 3.25E-06 mr1725 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 9.79E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 4.57E-08 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 5.88E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 4.10E-06 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200200887 NA 5.08E-07 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251