\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200189034:

Variant ID: vg1200189034 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 189034
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTTGCTTTGACGTGCAGGGTATTTCTGGCCGACAATGCTGGAGGATTGTTTCAGATATTACAAGGGATGTCAAGATTGTCAAAAATTTGGAGCAATTCA[T/A]
TGGGCACCGGCATCGGCTATGAATCCTATCATTAAACATTGGCCATTTAGAGGTTGGGGAATTGATATGATCGGCATGATTAATCCACCATCGAGTAAGG

Reverse complement sequence

CCTTACTCGATGGTGGATTAATCATGCCGATCATATCAATTCCCCAACCTCTAAATGGCCAATGTTTAATGATAGGATTCATAGCCGATGCCGGTGCCCA[A/T]
TGAATTGCTCCAAATTTTTGACAATCTTGACATCCCTTGTAATATCTGAAACAATCCTCCAGCATTGTCGGCCAGAAATACCCTGCACGTCAAAGCAACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 0.30% 11.34% 37.56% NA
All Indica  2759 22.50% 0.40% 17.22% 59.80% NA
All Japonica  1512 96.20% 0.00% 0.26% 3.51% NA
Aus  269 63.20% 0.00% 17.47% 19.33% NA
Indica I  595 26.90% 0.30% 10.08% 62.69% NA
Indica II  465 14.60% 0.00% 10.54% 74.84% NA
Indica III  913 20.60% 0.80% 27.60% 51.04% NA
Indica Intermediate  786 26.20% 0.40% 14.50% 58.91% NA
Temperate Japonica  767 94.80% 0.00% 0.26% 4.95% NA
Tropical Japonica  504 97.40% 0.00% 0.40% 2.18% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 95.80% 0.00% 3.12% 1.04% NA
Intermediate  90 71.10% 0.00% 7.78% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200189034 T -> DEL LOC_Os12g01330.1 N frameshift_variant Average:9.92; most accessible tissue: Callus, score: 37.254 N N N N
vg1200189034 T -> A LOC_Os12g01330.1 missense_variant ; p.His701Gln; MODERATE nonsynonymous_codon ; H701Q Average:9.92; most accessible tissue: Callus, score: 37.254 possibly damaging -1.953 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200189034 NA 1.14E-21 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 1.50E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 1.33E-13 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 5.20E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 2.17E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 2.48E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 8.00E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 6.71E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 9.58E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 1.25E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 2.48E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 7.89E-06 1.23E-07 mr1642 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 2.53E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 2.02E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 4.35E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 3.74E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 7.36E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200189034 NA 9.77E-23 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251