\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200183647:

Variant ID: vg1200183647 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 183647
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATGCTATGCAACACGCTTTGATCAACCAATCTGGAGTGCTAGTCAATACTTTGTCAAATATGGTGAAGTCGATTGTTGATGGCACAATAGCTGAATA[C/T]
CAGGCTACAGGACCGGTTTATTTGCCAGGAGGTGTTTTCCCGAATTATCGGCCCTTAATCACCGATAATCAGCCAGCTGTTAAGTCAGTTCCTCTCAATG

Reverse complement sequence

CATTGAGAGGAACTGACTTAACAGCTGGCTGATTATCGGTGATTAAGGGCCGATAATTCGGGAAAACACCTCCTGGCAAATAAACCGGTCCTGTAGCCTG[G/A]
TATTCAGCTATTGTGCCATCAACAATCGACTTCACCATATTTGACAAAGTATTGACTAGCACTCCAGATTGGTTGATCAAAGCGTGTTGCATAGCATAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 0.10% 6.24% 44.01% NA
All Indica  2759 21.10% 0.10% 8.70% 70.06% NA
All Japonica  1512 96.20% 0.00% 0.20% 3.57% NA
Aus  269 58.70% 0.00% 16.73% 24.54% NA
Indica I  595 25.20% 0.00% 7.73% 67.06% NA
Indica II  465 14.60% 0.00% 4.95% 80.43% NA
Indica III  913 20.50% 0.30% 11.17% 68.02% NA
Indica Intermediate  786 22.50% 0.10% 8.78% 68.58% NA
Temperate Japonica  767 94.70% 0.00% 0.39% 4.95% NA
Tropical Japonica  504 97.60% 0.00% 0.00% 2.38% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 94.80% 0.00% 2.08% 3.12% NA
Intermediate  90 67.80% 0.00% 5.56% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200183647 C -> DEL LOC_Os12g01320.1 N frameshift_variant Average:22.561; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1200183647 C -> T LOC_Os12g01320.1 synonymous_variant ; p.Tyr583Tyr; LOW synonymous_codon Average:22.561; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200183647 NA 3.06E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 3.25E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 2.87E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 2.17E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 1.42E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 3.25E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 2.52E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 1.82E-06 1.82E-06 mr1323 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 9.05E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 1.57E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 1.58E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 1.91E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 7.81E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 1.53E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 2.88E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 1.20E-06 1.19E-06 mr1540 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 8.69E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 3.92E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 1.26E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 4.44E-06 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 3.63E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 1.67E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 8.55E-07 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 1.93E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 2.24E-07 NA mr1808 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 6.57E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 NA 2.12E-24 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647 8.00E-06 NA mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251