Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200183647:

Variant ID: vg1200183647 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 183647
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

ACTATGCTATGCAACACGCTTTGATCAACCAATCTGGAGTGCTAGTCAATACTTTGTCAAATATGGTGAAGTCGATTGTTGATGGCACAATAGCTGAATA[C/T]
CAGGCTACAGGACCGGTTTATTTGCCAGGAGGTGTTTTCCCGAATTATCGGCCCTTAATCACCGATAATCAGCCAGCTGTTAAGTCAGTTCCTCTCAATG

Reverse complement sequence

CATTGAGAGGAACTGACTTAACAGCTGGCTGATTATCGGTGATTAAGGGCCGATAATTCGGGAAAACACCTCCTGGCAAATAAACCGGTCCTGTAGCCTG[G/A]
TATTCAGCTATTGTGCCATCAACAATCGACTTCACCATATTTGACAAAGTATTGACTAGCACTCCAGATTGGTTGATCAAAGCGTGTTGCATAGCATAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	0.10%	6.24%	44.01%	NA
All Indica	2759	21.10%	0.10%	8.70%	70.06%	NA
All Japonica	1512	96.20%	0.00%	0.20%	3.57%	NA
Aus	269	58.70%	0.00%	16.73%	24.54%	NA
Indica I	595	25.20%	0.00%	7.73%	67.06%	NA
Indica II	465	14.60%	0.00%	4.95%	80.43%	NA
Indica III	913	20.50%	0.30%	11.17%	68.02%	NA
Indica Intermediate	786	22.50%	0.10%	8.78%	68.58%	NA
Temperate Japonica	767	94.70%	0.00%	0.39%	4.95%	NA
Tropical Japonica	504	97.60%	0.00%	0.00%	2.38%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	94.80%	0.00%	2.08%	3.12%	NA
Intermediate	90	67.80%	0.00%	5.56%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200183647	C -> DEL	LOC_Os12g01320.1	N	frameshift_variant	Average:22.561; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1200183647	C -> T	LOC_Os12g01320.1	synonymous_variant ; p.Tyr583Tyr; LOW	synonymous_codon	Average:22.561; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200183647	NA	3.06E-20	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	3.25E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	2.87E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	2.17E-16	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	1.42E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	3.25E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	2.52E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	1.82E-06	1.82E-06	mr1323	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	9.05E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	1.57E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	1.58E-06	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	1.91E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	7.81E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	1.53E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	2.88E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	1.20E-06	1.19E-06	mr1540	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	8.69E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	3.92E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	1.26E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	4.44E-06	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	3.63E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	1.67E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	8.55E-07	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	1.93E-08	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	2.24E-07	NA	mr1808	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	6.57E-08	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	NA	2.12E-24	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200183647	8.00E-06	NA	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251