\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200182981:

Variant ID: vg1200182981 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 182981
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATTGCAGGATCAAATCAACTGGCACGATAGCATACCCGAAGGCGAGTTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAGGCCTCGTGTTTTTAC[G/A]
TCAACACGCTTTTGGCACGCCCGGTGGGACAGATCAGAAGTCAGAATCACAACAGCAATTTTCCTCATGGCCGAGAAACCGCCAGCATCGCCGTCTTCGG

Reverse complement sequence

CCGAAGACGGCGATGCTGGCGGTTTCTCGGCCATGAGGAAAATTGCTGTTGTGATTCTGACTTCTGATCTGTCCCACCGGGCGTGCCAAAAGCGTGTTGA[C/T]
GTAAAAACACGAGGCCTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAACTCGCCTTCGGGTATGCTATCGTGCCAGTTGATTTGATCCTGCAATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 0.40% 7.41% 42.51% NA
All Indica  2759 21.40% 0.60% 10.58% 67.45% NA
All Japonica  1512 96.20% 0.10% 0.13% 3.57% NA
Aus  269 56.10% 0.00% 18.59% 25.28% NA
Indica I  595 23.90% 0.00% 9.75% 66.39% NA
Indica II  465 15.10% 0.00% 4.73% 80.22% NA
Indica III  913 22.80% 1.40% 13.69% 62.10% NA
Indica Intermediate  786 21.60% 0.40% 11.07% 66.92% NA
Temperate Japonica  767 94.80% 0.00% 0.26% 4.95% NA
Tropical Japonica  504 97.40% 0.20% 0.00% 2.38% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 68.90% 0.00% 6.67% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200182981 G -> DEL LOC_Os12g01320.1 N frameshift_variant Average:11.139; most accessible tissue: Callus, score: 27.862 N N N N
vg1200182981 G -> A LOC_Os12g01320.1 synonymous_variant ; p.Thr439Thr; LOW synonymous_codon Average:11.139; most accessible tissue: Callus, score: 27.862 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200182981 NA 1.63E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 2.54E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 9.34E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 1.30E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 1.11E-17 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 4.46E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 1.30E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 1.84E-06 NA mr1221 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 8.07E-06 NA mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 7.70E-17 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 4.82E-06 4.82E-06 mr1323 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 2.97E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 2.72E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 2.23E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 9.95E-06 6.68E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 3.27E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 5.91E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 2.60E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 1.82E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 9.62E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 7.22E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 5.27E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 7.95E-06 2.84E-09 mr1781 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 6.78E-07 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 1.85E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 4.88E-06 NA mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 5.06E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981 NA 2.08E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251