Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200182981:

Variant ID: vg1200182981 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 182981
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGATTGCAGGATCAAATCAACTGGCACGATAGCATACCCGAAGGCGAGTTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAGGCCTCGTGTTTTTAC[G/A]
TCAACACGCTTTTGGCACGCCCGGTGGGACAGATCAGAAGTCAGAATCACAACAGCAATTTTCCTCATGGCCGAGAAACCGCCAGCATCGCCGTCTTCGG

Reverse complement sequence

CCGAAGACGGCGATGCTGGCGGTTTCTCGGCCATGAGGAAAATTGCTGTTGTGATTCTGACTTCTGATCTGTCCCACCGGGCGTGCCAAAAGCGTGTTGA[C/T]
GTAAAAACACGAGGCCTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAACTCGCCTTCGGGTATGCTATCGTGCCAGTTGATTTGATCCTGCAATCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	0.40%	7.41%	42.51%	NA
All Indica	2759	21.40%	0.60%	10.58%	67.45%	NA
All Japonica	1512	96.20%	0.10%	0.13%	3.57%	NA
Aus	269	56.10%	0.00%	18.59%	25.28%	NA
Indica I	595	23.90%	0.00%	9.75%	66.39%	NA
Indica II	465	15.10%	0.00%	4.73%	80.22%	NA
Indica III	913	22.80%	1.40%	13.69%	62.10%	NA
Indica Intermediate	786	21.60%	0.40%	11.07%	66.92%	NA
Temperate Japonica	767	94.80%	0.00%	0.26%	4.95%	NA
Tropical Japonica	504	97.40%	0.20%	0.00%	2.38%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	68.90%	0.00%	6.67%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200182981	G -> DEL	LOC_Os12g01320.1	N	frameshift_variant	Average:11.139; most accessible tissue: Callus, score: 27.862	N	N	N	N
vg1200182981	G -> A	LOC_Os12g01320.1	synonymous_variant ; p.Thr439Thr; LOW	synonymous_codon	Average:11.139; most accessible tissue: Callus, score: 27.862	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200182981	NA	1.63E-20	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	2.54E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	9.34E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	1.30E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	1.11E-17	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	4.46E-09	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	1.30E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	1.84E-06	NA	mr1221	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	8.07E-06	NA	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	7.70E-17	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	4.82E-06	4.82E-06	mr1323	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	2.97E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	2.72E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	2.23E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	9.95E-06	6.68E-07	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	3.27E-21	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	5.91E-15	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	2.60E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	1.82E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	9.62E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	7.22E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	5.27E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	7.95E-06	2.84E-09	mr1781	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	6.78E-07	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	1.85E-08	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	4.88E-06	NA	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	5.06E-08	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200182981	NA	2.08E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251