\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200181061:

Variant ID: vg1200181061 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 181061
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTAGAGAGACAAGGCTACACCTCTTCTTCTTATGTCCTTTCAGCATCAGGTGTTGGCAATACCTGGGAATTGAGTGGAATAATAATTTGGAGTTTTTCC[C/A]
AATGATATCCCTAGCAAGAATCAAATTTGCTCAGAAGGGTTTCCTGGAAATTTTCTTTTTGGCAGCTTGGCACATTTGGAAGCAAAGGAATGGCTTCATA

Reverse complement sequence

TATGAAGCCATTCCTTTGCTTCCAAATGTGCCAAGCTGCCAAAAAGAAAATTTCCAGGAAACCCTTCTGAGCAAATTTGATTCTTGCTAGGGATATCATT[G/T]
GGAAAAACTCCAAATTATTATTCCACTCAATTCCCAGGTATTGCCAACACCTGATGCTGAAAGGACATAAGAAGAAGAGGTGTAGCCTTGTCTCTCTACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 0.40% 8.27% 42.66% NA
All Indica  2759 19.70% 0.50% 9.39% 70.42% NA
All Japonica  1512 96.10% 0.30% 1.06% 2.58% NA
Aus  269 56.50% 0.00% 40.89% 2.60% NA
Indica I  595 23.20% 0.30% 7.56% 68.91% NA
Indica II  465 12.70% 0.90% 9.89% 76.56% NA
Indica III  913 19.60% 0.30% 9.42% 70.65% NA
Indica Intermediate  786 21.20% 0.60% 10.43% 67.68% NA
Temperate Japonica  767 94.50% 0.50% 1.69% 3.26% NA
Tropical Japonica  504 97.40% 0.00% 0.20% 2.38% NA
Japonica Intermediate  241 98.30% 0.00% 0.83% 0.83% NA
VI/Aromatic  96 94.80% 0.00% 1.04% 4.17% NA
Intermediate  90 68.90% 0.00% 5.56% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200181061 C -> DEL N N silent_mutation Average:14.333; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1200181061 C -> A LOC_Os12g01310.1 upstream_gene_variant ; 3185.0bp to feature; MODIFIER silent_mutation Average:14.333; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1200181061 C -> A LOC_Os12g01320.1 intron_variant ; MODIFIER silent_mutation Average:14.333; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200181061 NA 8.87E-21 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 3.00E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 8.72E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 9.51E-17 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 1.56E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 3.44E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 6.34E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 8.29E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 3.19E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 8.40E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 1.38E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 4.12E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 1.49E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 2.98E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 5.19E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 2.81E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 3.09E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 4.76E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 9.56E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 1.22E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 4.12E-25 mr1316_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 7.65E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 2.69E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200181061 NA 1.32E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251