\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200180797:

Variant ID: vg1200180797 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 180797
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTACAATCAGGGATGGGGGATGCTTGGAATTTTATCTGGGACTCAGATAAGTACACAGCTAAGAAATTCTATAAGCTAAATTATTCTGCATTGCAAC[T/C,A]
CCCCAGGCCCATGATTTGGCTATGGAAAACAAAATGTGTCATGAAGATCAAAGTCTTTGCCTGGCTAATGTTCTGTGATAGGCTCAATACAAGAGATATG

Reverse complement sequence

CATATCTCTTGTATTGAGCCTATCACAGAACATTAGCCAGGCAAAGACTTTGATCTTCATGACACATTTTGTTTTCCATAGCCAAATCATGGGCCTGGGG[A/G,T]
GTTGCAATGCAGAATAATTTAGCTTATAGAATTTCTTAGCTGTGTACTTATCTGAGTCCCAGATAAAATTCCAAGCATCCCCCATCCCTGATTGTAAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 47.40% 1.33% 0.78% NA
All Indica  2759 79.70% 18.20% 1.70% 0.40% NA
All Japonica  1512 2.20% 96.00% 0.13% 1.59% NA
Aus  269 44.20% 51.70% 4.09% 0.00% NA
Indica I  595 77.10% 20.20% 1.85% 0.84% NA
Indica II  465 84.90% 13.10% 0.86% 1.08% NA
Indica III  913 80.00% 18.80% 1.20% 0.00% NA
Indica Intermediate  786 78.40% 18.80% 2.67% 0.13% NA
Temperate Japonica  767 3.30% 94.50% 0.00% 2.22% NA
Tropical Japonica  504 1.20% 97.40% 0.20% 1.19% NA
Japonica Intermediate  241 1.20% 97.90% 0.41% 0.41% NA
VI/Aromatic  96 3.10% 93.80% 2.08% 1.04% NA
Intermediate  90 32.20% 65.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200180797 T -> C LOC_Os12g01320.1 missense_variant ; p.Leu362Pro; MODERATE nonsynonymous_codon ; L362P Average:13.963; most accessible tissue: Callus, score: 35.887 unknown unknown TOLERATED 0.47
vg1200180797 T -> DEL LOC_Os12g01320.1 N frameshift_variant Average:13.963; most accessible tissue: Callus, score: 35.887 N N N N
vg1200180797 T -> A LOC_Os12g01320.1 missense_variant ; p.Leu362His; MODERATE N Average:13.963; most accessible tissue: Callus, score: 35.887 N N N N
vg1200180797 T -> A LOC_Os12g01310.1 upstream_gene_variant ; 2921.0bp to feature; MODIFIER N Average:13.963; most accessible tissue: Callus, score: 35.887 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200180797 NA 2.32E-21 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 2.59E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 4.20E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 4.06E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 2.36E-17 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 7.75E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 3.89E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 4.62E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 4.31E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 2.14E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 2.77E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 3.55E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 7.89E-06 4.82E-07 mr1448 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 9.31E-22 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 1.07E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 3.86E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 7.14E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 6.66E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 9.19E-08 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 6.35E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 6.48E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 2.20E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 9.22E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 5.32E-27 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200180797 NA 6.68E-25 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251