\
| Variant ID: vg1200180797 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 180797 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 74. )
ACTTTACAATCAGGGATGGGGGATGCTTGGAATTTTATCTGGGACTCAGATAAGTACACAGCTAAGAAATTCTATAAGCTAAATTATTCTGCATTGCAAC[T/C,A]
CCCCAGGCCCATGATTTGGCTATGGAAAACAAAATGTGTCATGAAGATCAAAGTCTTTGCCTGGCTAATGTTCTGTGATAGGCTCAATACAAGAGATATG
CATATCTCTTGTATTGAGCCTATCACAGAACATTAGCCAGGCAAAGACTTTGATCTTCATGACACATTTTGTTTTCCATAGCCAAATCATGGGCCTGGGG[A/G,T]
GTTGCAATGCAGAATAATTTAGCTTATAGAATTTCTTAGCTGTGTACTTATCTGAGTCCCAGATAAAATTCCAAGCATCCCCCATCCCTGATTGTAAAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.50% | 47.40% | 1.33% | 0.78% | NA |
| All Indica | 2759 | 79.70% | 18.20% | 1.70% | 0.40% | NA |
| All Japonica | 1512 | 2.20% | 96.00% | 0.13% | 1.59% | NA |
| Aus | 269 | 44.20% | 51.70% | 4.09% | 0.00% | NA |
| Indica I | 595 | 77.10% | 20.20% | 1.85% | 0.84% | NA |
| Indica II | 465 | 84.90% | 13.10% | 0.86% | 1.08% | NA |
| Indica III | 913 | 80.00% | 18.80% | 1.20% | 0.00% | NA |
| Indica Intermediate | 786 | 78.40% | 18.80% | 2.67% | 0.13% | NA |
| Temperate Japonica | 767 | 3.30% | 94.50% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 1.20% | 97.40% | 0.20% | 1.19% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.90% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 3.10% | 93.80% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 32.20% | 65.60% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200180797 | T -> C | LOC_Os12g01320.1 | missense_variant ; p.Leu362Pro; MODERATE | nonsynonymous_codon ; L362P | Average:13.963; most accessible tissue: Callus, score: 35.887 | unknown | unknown | TOLERATED | 0.47 |
| vg1200180797 | T -> DEL | LOC_Os12g01320.1 | N | frameshift_variant | Average:13.963; most accessible tissue: Callus, score: 35.887 | N | N | N | N |
| vg1200180797 | T -> A | LOC_Os12g01320.1 | missense_variant ; p.Leu362His; MODERATE | N | Average:13.963; most accessible tissue: Callus, score: 35.887 | N | N | N | N |
| vg1200180797 | T -> A | LOC_Os12g01310.1 | upstream_gene_variant ; 2921.0bp to feature; MODIFIER | N | Average:13.963; most accessible tissue: Callus, score: 35.887 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200180797 | NA | 2.32E-21 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 2.59E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 4.20E-14 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 4.06E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 2.36E-17 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 7.75E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 3.89E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 4.62E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 4.31E-16 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 2.14E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 2.77E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 3.55E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | 7.89E-06 | 4.82E-07 | mr1448 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 9.31E-22 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 1.07E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 3.86E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 7.14E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 6.66E-13 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 9.19E-08 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 6.35E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 6.48E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 2.20E-21 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 9.22E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 5.32E-27 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180797 | NA | 6.68E-25 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |