\
| Variant ID: vg1200180389 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 180389 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGAGTTCAAAACACAGCCCTTCTTCTAAAGCATATGGTCAAGTTCTATAATGGTGCTGATTTACCATGGGTGAAATTAATCTCACAATCATATTATGAGT[A/C]
TAAAGTTCCACACTTGATGATGAATAAGGGTTCTTTTTGGTGGAGGGACATCACATCTCTTGCAGACATATTCAGGGGGATAGCAAAATGCGAAATCAGG
CCTGATTTCGCATTTTGCTATCCCCCTGAATATGTCTGCAAGAGATGTGATGTCCCTCCACCAAAAAGAACCCTTATTCATCATCAAGTGTGGAACTTTA[T/G]
ACTCATAATATGATTGTGAGATTAATTTCACCCATGGTAAATCAGCACCATTATAGAACTTGACCATATGCTTTAGAAGAAGGGCTGTGTTTTGAACTCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.40% | 0.80% | 18.79% | 30.98% | NA |
| All Indica | 2759 | 20.20% | 1.40% | 27.65% | 50.71% | NA |
| All Japonica | 1512 | 96.00% | 0.10% | 1.12% | 2.78% | NA |
| Aus | 269 | 62.80% | 0.00% | 36.06% | 1.12% | NA |
| Indica I | 595 | 22.50% | 1.50% | 28.57% | 47.39% | NA |
| Indica II | 465 | 13.10% | 2.40% | 38.06% | 46.45% | NA |
| Indica III | 913 | 20.50% | 1.00% | 22.23% | 56.30% | NA |
| Indica Intermediate | 786 | 22.40% | 1.30% | 27.10% | 49.24% | NA |
| Temperate Japonica | 767 | 94.50% | 0.00% | 1.83% | 3.65% | NA |
| Tropical Japonica | 504 | 97.40% | 0.00% | 0.20% | 2.38% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.40% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 3.12% | 2.08% | NA |
| Intermediate | 90 | 71.10% | 0.00% | 8.89% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200180389 | A -> C | LOC_Os12g01320.1 | missense_variant ; p.Tyr284Ser; MODERATE | nonsynonymous_codon ; Y284S | Average:16.865; most accessible tissue: Zhenshan97 root, score: 39.742 | unknown | unknown | TOLERATED | 0.61 |
| vg1200180389 | A -> DEL | LOC_Os12g01320.1 | N | frameshift_variant | Average:16.865; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200180389 | NA | 6.32E-20 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 4.15E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 7.99E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 5.13E-16 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 2.55E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 4.20E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 1.17E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 1.50E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 1.58E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 8.78E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 1.11E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 6.12E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 1.57E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 4.43E-13 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 6.94E-08 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 5.89E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | 4.80E-06 | NA | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 1.21E-06 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 9.54E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 5.87E-28 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | 8.33E-06 | 9.51E-27 | mr1316_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200180389 | NA | 1.15E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |