\
| Variant ID: vg1200003632 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3632 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )
TTAACTATGACAGGAGTGGAAGATCCAAGGTTCCAAACCCCACCTTTCTTTTTTCTTTTACTTAATATGTGTCACTCTTTTTATGTTAAAATGCTCATTA[C/T]
TCATACCCTGTTTTGCCAGGGAACTGCAGAGGTTGTATTTTCCAGAAAATCTGACGCCCTGGCTGCTGTTAAGAGGTACAACAATGTGCAGCTGGATGGC
GCCATCCAGCTGCACATTGTTGTACCTCTTAACAGCAGCCAGGGCGTCAGATTTTCTGGAAAATACAACCTCTGCAGTTCCCTGGCAAAACAGGGTATGA[G/A]
TAATGAGCATTTTAACATAAAAAGAGTGACACATATTAAGTAAAAGAAAAAAGAAAGGTGGGGTTTGGAACCTTGGATCTTCCACTCCTGTCATAGTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 0.10% | 1.82% | 16.74% | NA |
| All Indica | 2759 | 90.00% | 0.00% | 1.45% | 8.55% | NA |
| All Japonica | 1512 | 63.60% | 0.10% | 2.84% | 33.47% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 97.30% | 0.00% | 0.00% | 2.69% | NA |
| Indica II | 465 | 64.10% | 0.20% | 6.45% | 29.25% | NA |
| Indica III | 913 | 95.90% | 0.00% | 0.44% | 3.61% | NA |
| Indica Intermediate | 786 | 92.70% | 0.00% | 0.76% | 6.49% | NA |
| Temperate Japonica | 767 | 81.40% | 0.00% | 1.96% | 16.69% | NA |
| Tropical Japonica | 504 | 34.30% | 0.40% | 4.37% | 60.91% | NA |
| Japonica Intermediate | 241 | 68.00% | 0.00% | 2.49% | 29.46% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 2.08% | 31.25% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 1.11% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200003632 | C -> DEL | N | N | silent_mutation | Average:32.599; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1200003632 | C -> T | LOC_Os12g01020.1 | downstream_gene_variant ; 1845.0bp to feature; MODIFIER | silent_mutation | Average:32.599; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1200003632 | C -> T | LOC_Os12g01010.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.599; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200003632 | NA | 1.71E-14 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 2.81E-11 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 6.33E-13 | mr1903 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 5.31E-17 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | 6.76E-06 | NA | mr1934 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 2.24E-14 | mr1934 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 8.49E-13 | mr1935 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 5.76E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 5.57E-15 | mr1889_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 1.31E-09 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 4.66E-14 | mr1907_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200003632 | NA | 1.28E-12 | mr1934_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |